|
|
| Year : 2008 | Volume
: 51
| Issue : 2 | Page : 175-181 |
|
| Hepatobiliary tuberculosis in western India |
|
|
Deepak N Amarapurkar1, Nikhil D Patel1, Anjali D Amarapurkar2
1 Department of Gastroenterology, Bombay Hospital and Medical Research Centre, India 2 1Department of Pathology, BYL Nair Charitable Hospital, TN Medical College, Mumbai, India
Click here for correspondence address and email
|
|
 |
|
Abstract | | |
Tuberculous involvement of liver as a part of disseminated tuberculosis is seen in up to 50-80% cases, but localized hepatobiliary tuberculosis (HBTB) is uncommonly described. During 6 years, a total of 280 consecutive patients with TB were evaluated prospectively for the presence and etiology of liver involvement. Cases with miliary TB or immunosuppression and cases receiving anti-tuberculosis drugs prior to presentation to our unit were excluded (38 cases). Details of clinical, biochemical and imaging findings and histology/microbiology were noted. Of 242 included cases, 38 patients (15.7%; age 38.1 ± 12.5 years; sex ratio 2.5:1) had HBTB, whereas 20 patients (9%; age 39.3 ± 16.3 years; sex ratio 2.1:1) had other liver diseases. Diagnosis of HBTB was based on caseating granuloma on histology (18/23 procedures), positive smear/culture for acid-fast bacilli (21/39 procedures) and positive polymerase chain reaction for Mycobacterium tuberculosis (28/29 procedures) when diagnostic procedures were guided by imaging results. Thirty-eight cases with HBTB were classified as follows [patients (n), (%)]: (A) hepatic TB [20 (52.6%)]: (1) granulomatous hepatitis - 10 (26.3%), (2) liver abscesses or pseudotumors - 10 (26.3%) and (3) calcified hepatic granuloma - 0 (0%); (B) biliary TB [15 (39.4%)]: (1) biliary strictures - 2 (5.2%), (2) gall bladder involvement - 1 (2.6%) and (3) biliary obstruction due to lymph node masses - 12 (31.5%); (C) mixed variety [3 (7.8%)]: (1) simultaneous granulomatous hepatitis and biliary stricture - 1 (2.6%) and (2) simultaneous lymph node involvement and calcified hepatic granuloma - 2 (5.2%). All the cases responded well to standard anti-tuberculosis therapy. HBTB forms an important subgroup in TB cases. It requires a combination of imaging, histological and microbiological procedures to define the diagnosis. HBTB responds well to treatment. Keywords: Biliary obstruction, biliary tuberculosis, gall bladder tuberculosis, granulomatous hepatitis, hepatic tuberculosis, liver abscess, tuberculosis in India
How to cite this article: Amarapurkar DN, Patel ND, Amarapurkar AD. Hepatobiliary tuberculosis in western India. Indian J Pathol Microbiol 2008;51:175-81 |
Introduction | |  |
Abdominal tuberculosis is common in gastroenterology practice and with the advent of colonoscopy, laparoscopy and upper gastrointestinal endoscopy, it is easier to make accurate diagnosis and avoid undue delay in management. Tuberculous involvement of liver as a part of disseminated tuberculosis is seen in up to 50-80% cases. [1] Indirect involvement of liver in the form of amyloidosis, fatty liver or drug toxicity in tuberculosis (TB) is common. [2] In contrast to this, localized hepatobiliary tuberculosis (HBTB) is uncommonly described even in countries like India with high prevalence of tuberculosis. [2],[3],[4] HBTB can mimic liver tumors, hilar tumors causing biliary obstruction, cholangiocarcinoma, periampullary tumors and liver abscesses. [5],[6],[7] Some patients with hepatic TB can present with pyrexia of unknown origin and liver histology shows caseating granulomas (CG). [8],[9] Hepatic TB can mimic other types of granulomatous hepatitis like sarcoidosis. [10],[11],[12] Hepatic biochemical abnormalities and imaging abnormalities can be encountered in abdominal TB without involvement of the liver due to TB. [2]
Although literature published on abdominal TB is vast, literature on HBTB is scanty. [1] A majority of these are in the form of case reports and have emphasized delay in diagnosis of a condition that is completely curable. Hence, we planned a study to evaluate patients seen with HBTB in a tertiary referral centre for their clinical features and diagnostic difficulties encountered.
Materials And Methods | |  |
Patient population
From January 1998 to October 2003, all patients with TB presenting to our unit (which is involved in the care of gastrointestinal and liver diseases) were prospectively evaluated for hepatobiliary involvement to find out cases with HBTB. The presence of hepatobiliary involvement was suspected on the basis of abnormal liver function tests (LFT) and/or imaging findings. In addition, all the patients who were referred for biliary obstruction and liver abscesses with confirmation of TB were also included in the study. Cases with disseminated or miliary TB, immunosuppression [human immunodeficiency virus (HIV) infection, immunosuppressants or organ transplant] and cases receiving anti-tuberculosis therapy (ATT) prior to referral to our unit were excluded.
Diagnostic criteria of localized hepatobiliary tuberculosis
In our analysis, HBTB was defined, in the absence of obvious involvement of gastrointestinal tract or peritoneum, on the basis of the following criteria: presence of clinical, laboratory and imaging evidence of hepatic and/or biliary involvement that was confirmed to be due to TB on the basis of microbiological and histopathology criteria. Gastrointestinal and peritoneal involvement was ruled out on the basis of clinical (history and examination), imaging [barium studies, ultrasonography (USG) of abdomen, computerized tomography (CT) of abdomen and/or magnetic resonance imaging (MRI) of abdomen] and morphological (endoscopy or laparoscopy) features. Diagnosis of TB was established when one of the following criteria was established: (1) presence of CG or non-caseating granuloma (NCG) with Langhans giant cells on histology, (2) demonstration of acid-fast bacilli (AFB) on smear or on histological section, (3) positive culture for mycobacteria, (4) positive guinea pig inoculation, (5) positive polymerase chain reaction for Mycobacterium tuberculosis (TB PCR).
Depending on the site of involvement, cases of HBTB were divided as follows: (A) hepatic TB comprising (1) granulomatous hepatitis, (2) liver abscess (centrally necrotizing lesion) or pseudo-tumour (solid lesion) and (3) calcified granuloma; (B) biliary TB comprising (1) biliary stricture, (2) gall bladder involvement and (3) biliary obstruction due to lymph node compression; (C) mixed variety.
Evaluation, treatment and follow-up of patients
The evaluation included detailed clinical history, clinical examination, LFT [including serum bilirubin, alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), gamma glutamyl transferase (GGT), albumin, globulin, prothrombin time], viral markers (including HBsAg, anti-HCV and HIV), imaging of the abdomen with special focus on hepatobiliary system [USG, CT, MRI and magnetic resonance cholangiopancreatography (MRCP) or endoscopic retrograde choledochopancreatography (ERCP) as and when required] and histopathology/microbiology [liver/biliary/lymph node histology/cytology for AFB/TB PCR/BACTEC culture for mycobacteria as and when required].
Initially, all the patients underwent USG, which was followed by either CT or MRI (if CT was contraindicated or was inconclusive) to confirm or further characterize ultrasonography features or to define the lesion if ultrasonography was inconclusive. Tissue material was obtained through aspiration and/or biopsy from the localized lesion or an enlarged lymph node whichever was possible. Liver biopsy was performed if imaging was showing generalized involvement of liver or cause of liver function abnormalities was not revealed. In cases with biliary involvement, MRI with MRCP was done if only biliary dilation was present on USG or where CT failed to characterize the lesion. To achieve biliary decompression (in case of symptomatic cholestasis) or to get tissue specimen, ERCP was performed. At ERCP, brush cytology as well as bile was taken, if there was presence of stricture, for cytology of malignant cells as well as for AFB smear/culture and TB PCR. Laparoscopy was performed to achieve tissue specimen when it was not possible to achieve tissue material through USG or CT from the lesion.
All fresh biopsy and aspirate specimens were subjected to Ziehl-Neelsen and fluorescence smear for AFB as well as to BACTEC culture for AFB. All paraffin-embedded biopsy specimens were reported by an experienced gastrointestinal pathologist after staining with hematoxylin and eosin. All aspirate materials (whenever aspiration was performed) or selected paraffin-embedded biopsy specimens (when AFB smear/culture was negative in a particular case) were tested for the detection of Mycobacterium tuberculosis complex by Gen-Probe's (USA) amplified Mycobacterium tuberculosis direct test by PCR assay. All samples were processed by the N-acetyl-L-cysteine-sodium hydroxide decontamination procedure prior to DNA extraction. After two phenolchloroform extractions, the DNA was precipitated by ethanol and finally re-suspended in 40 µl of distilled water. Oligonucleotide primers for the detection of Mycobacterium tuberculosis were selected to amplify a 123-base pair fragment of the 5´ portion of IS 6100, which is specific for Mycobacterium tuberculosis and contains an internal endonuclease site that allows confirmation of the product by digestion of the endonuclease. The sequences of the primers (5´ to 3´) were CCTGCGAGCGTAGGCGTCGG and CTCGTCCAGCGCCGCTTCGG. Amplifications were performed in 30 cycles using thermostable DNA polymerase. After PCR amplification, the product was analyzed by electrophoresis on 1.8% agarose gels or 12% acrylamide gels stained with ethidium bromide and visualized by ultraviolet transilluminator. PCR quality controls were maintained by taking strict precautions to avoid contamination in laboratory while performing each step, including using disposable equipments. Positive and negative PCR controls were included with each set of reactions. To demonstrate the presence of substance capable of inhibiting amplification, all negative samples were tested by PCR for the human β-globin gene containing 110-base pair sequences.
After establishing diagnosis of TB, all the patients were treated with standard ATT comprising isoniazid (H) 5 mg/kg/day up to a maximum of 300 mg/day PO for 12 months; rifampicin (R) 10 mg/kg/day up to a maximum of 600 mg/day PO for 12 months; ethambutol (E) 15 mg/kg/day up to a maximum of 1200 mg/day PO for initial 2 months; and pyrazinamide (Z) 25 mg/kg/day up to a maximum of 2000 mg/day PO for initial 2 months [(HERZ) 2 (HR) 10 ].
All the patients were followed up initially every 7 days with clinical evaluation and LFT for 1 month, subsequently every 3 monthly with clinical evaluation, LFT and imaging till the end of therapy. Complete resolution of symptoms and morphological features after completion of standard ATT was taken as criteria for successful treatment.
Statistical analysis
Comparison between various subgroups of HBTB was done using Chi-squared test and level of significance for P was taken as 0.05.
Results | |  |
Patient population [Figure 1]
A total of 280 patients with TB were evaluated for HBTB. Out of 280 patients, 38 patients (13.5%) were excluded on the following criteria [patients ( n ) (%)]: miliary TB - 6 (15.7%), HIV infection - 10 (26.3%), ATT-induced hepatotoxicity - 12 (31.5%), patients on ATT for diagnosis of HBTB - 4 (10.5%) and post-solid organ transplant patients under immunosuppressants - 6 (15.7%). Of the remaining 242 patients, 184 cases (76%; mean age 34.3 ± 19.8 years; sex ratio 1.3:1) did not show any evidence of hepatobiliary involvement. Of the 58 (23.9%) patients with hepatobiliary involvement, 38 patients (15.7% of 242 patients; mean age 38 ± 12 years; age = 19-65 years; sex ratio 2.5:1) had HBTB. In the remaining 20 patients (8.3% of 242 patients; mean age 39.3 ± 16.3 years; sex ratio 2.1:1) of hepatobiliary involvement, etiologies were as follows [patients ( n ) (%)]: chronic hepatitis B infection - 1 (5%), chronic hepatitis C infection - 1 (5%), alcoholic liver disease - 4 (20%), extra-hepatic portal vein thrombosis - 2 (10%) and non-alcoholic fatty liver disease - 12 (60%).
Subtypes of hepatobiliary tuberculosis [Figure 1]
Thirty-eight cases with HBTB were classified as follows [patients ( n ) (%)]: (A) hepatic TB [20 (52.6%)]: (A1) granulomatous hepatitis - 10 (26.3%), (A2) liver abscesses or pseudotumors - 10 (26.3%) and (A3) calcified hepatic granuloma - 0 (0%); (B) biliary TB [15 (39.4%)]: (B1) biliary strictures - 2 (5.2%), (B2) gall bladder involvement - 1 (2.6%) and (B3) biliary obstruction due to lymph node masses - 12 (31.5%); (C) mixed variety [3 (7.8%)]: (C1) simultaneous granulomatous hepatitis and biliary stricture - 1 (2.6%) and (C2) simultaneous lymph node involvement and calcified hepatic granuloma - 2 (5.2%).
Clinical and biochemical features of HBTB
The mean duration of symptoms in these patients was 3.5 ± 1.8 months. Other clinical and laboratory features of HBTB and subgroups are described in [Table 1]. A patient with gallbladder dysfunction had persistent post-cholecystectomy fistula. He had undergone cholecystectomy for right upper abdominal pain; his pre-operative USG showed thick gall bladder wall and histology of cholecystectomy was not available. Associated pulmonary (11 patients - positive AFB smear/culture in 2 patients) and peripheral lymph node involvement (5 patients - CG in 2 patients, AFB smear positive in 1 patient) was seen in a total of 15 (37.4%) patients. Serum transaminases (AST and ALT) were elevated from 1.5 to 2 times of upper limit of normal in 17 (44.7%) cases of HBTB.
Imaging features and diagnostic procedures in HBTB
In group A1, initial USG was done in all 10 patients; subsequently CT and MRI was done in 8 and 2 (in whom CT was contraindicated) patients, respectively. Imaging features were as follows [patients ( n ) (%)]: (1) USG: hepatomegaly - 6/10 (60%), fatty liver - 5/10 (50%), nodularity - 1/10 (10%) and normal - 4 (40%); (2) CT and MRI: hepatomegaly - 8/10 (80%), nodularity - 4/10 (40%), fatty liver - 5/10 (50%) and normal - 2 (20%).
In group A2, USG was done in all 10 patients and CT was done in 3 patients (where USG was normal). Imaging features were as follows [patients ( n ) (%)]: (1) USG: hepatomegaly - 9/10 (100%), fatty liver - 3/10 (30%), space-occupying solid hepatic lesion - 1/10 (10%) and space-occupying centrally necrotizing hepatic lesion - 6/10 (60%); (2) CT: hepatomegaly - 3/3 (100%) and space-occupying solid hepatic lesion - 3/3 (100%).
In both the patients of group B1, USG showed the presence of biliary dilation; subsequent MRI with MRCP showed the presence of mid-common bile duct biliary stricture. In both the patients, ERCP (confirmed presence of stricture in both) was performed with biliary sampling followed by therapeutic dilation and stenting.
In one patient of group B2, USG was normal and MRI with MRCP showed the presence of biliary fistula originating from the cholecystectomy site. ERCP performed in this patient showed leak from cholecystectomy site and therapeutic stenting was done.
In group B3, USG was done in all 12 patients and showed the following features [patients ( n ) (%)]: biliary dilation - 12/12 (100%), pancreatic head mass - 2/12 (16.6%), hilar mass - 2/12 (16.6%), hepatomegaly - 3/12 (25%) and fatty liver - 4/12 (33.3%). Then, CT was done in all 4 (which showed the presence of mass on USG) and MRI with MRCP was offered to the remaining 8 patients; they showed the following features [patients ( n ) (%)]: biliary dilation - 12/12 (100%), necrotising hilar mass - 2/12 (16.6%), peripancreatic lymph node mass adjacent to the head of pancreas - 7/12 (58.3%) [Of which 5 were necrotising], hepatomegaly - 2/12 (16.6%) and fatty liver - 3/12 (25%). In 7 patients of this group, therapeutic ERCP was performed to relieve biliary obstruction (biliary stenting) that showed external biliary compression in all 7 cases.
In the group C1 patient, USG showed biliary dilation; MRI with MRCP showed hepatic nodularity and presence of lower common bile duct stricture; ERCP was done as therapeutic procedure offering biliary dilation and stenting.
In both the patients of group C2, USG showed biliary dilation and presence of peripancreatic mass; CT showed the presence of enlarged necrotizing peripancreatic lymph nodes adjacent to the head of pancreas, biliary dilation and calcified granuloma in liver parenchyma.
The details of procedures to achieve tissue material and yield of various diagnostic procedures are tabulated in [Table 2]. All the 11 liver biopsies (in A1 and C1) were done under USG guidance, whereas lymph node biopsies (in B3 and C2) were achieved with USG/CT in 10 and with laparoscopy in 2 patients. In A2, liver lesions were aspirated under USG guidance in 7 and under CT in 3 patients. In B3, lymph node aspiration was done through CT in 2 patients. Bile sampled from draining fluid of post-cholecystectomy fistula in 1 patient of B2 was positive for TB work-up. In 11 cases of ERCP (in 2 of B1, 1 of B2, 7 of B3 and 1 of C1), all the cases were negative for malignant cell cytology; only two cases in B1 and one case of C1 yielded diagnosis of TB; all other cases (of B2 and B3) were negative for TB work-up.
Of 11 HBTB cases that underwent liver biopsy, among the associated findings on histology, eight cases (72.7%) showed the presence of macrovesicular fatty infiltration, three (27.2%) showed non-specific mononuclear inflammatory changes and none (0%) showed the presence of amyloidosis.
Diagnostic criteria
All the patients were diagnosed on the basis of the diagnostic criteria described in 'Methods and materials'. Sensitivity of various diagnostic criteria is described in [Table 3]. On 23 biopsy procedures, various diagnostic criteria were present as follows: CG alone - 5 (21.7%), CG + positive AFB - 3 (13%), CG + positive TB PCR - 5 (21.7%), CG + positive AFB + positive TB PCR - 5 (21.7%), NCG alone - 1 (4.3%) (read the footnote to [Table 2]], NCG + positive AFB - 2 (8.6%) and NCG + positive TB PCR - 2 (8.6%). On 16 aspiration procedures, various diagnostic criteria were present as follows: positive TB PCR alone in 5 (31.2%) and positive TB PCR + positive AFB - 11 (68.8%).
Follow-up details
There was no mortality in HBTB cases. One patient had skin rash following the start of ATT, which was stopped until rash disappeared and there was no recurrence of skin rash on sequential reintroduction of ATT according to the World Health Organization guidelines. [13] Despite the presence of initial abnormal LFT, none of the patients had worsening of LFT on ATT. All the HBTB cases showed complete response to ATT at the end of therapy.
Discussion | |  |
In a previous series by Alvarez et al , 130 cases of hepatic TB were described over a period of 20 years. [1] In a 6-year study by Essop et al , 10 patients out of a total of 96 patients had localized HBTB. [14] We have come across 42 patients of HBTB (38 included and 4 excluded from the study) while analyzing the data of 280 cases with TB over a period of 6 years.
Demographical profile in our study was comparable to previously described series. [1] In our series, non-specific systemic symptoms like fever, weight loss and anorexia were commoner than specific symptoms suggestive of hepatobiliary involvement (abdominal pain, itching and jaundice). This was similar to that described by Alvarez et al . [1] The mean duration of symptoms before diagnosis was shorter in our series as compared to a study by Alvarez et al . [1] In our study, hepatomegaly was present in more than 40% and splenomegaly in more than 20% cases, which were in accordance to a previous series. In the world literature, the presence of hepatomegaly is seen in 13-80% cases of abdominal TB, in 71% of miliary TB and in 71-96% cases of HBTB. [1],[4],[14],[15],[16] Tender hepatomegaly was described in 30-60% cases of HBTB. [1],[14],[15],[16] Splenomegaly was described in 20-60% of HBTB as compared to 32% of miliary TB. [1],[14],[15] Hyperbilirubinemia in HBTB can be due to intra-hepatic cholestasis or due to extra-hepatic biliary obstruction or rarely due to hepatic failure. In our series, hyperbilirubinemia was seen in 18.4%. In a previous series, it was described to be present in 11.4-50% cases with HBTB. [1],[14],[15],[16] In the study by Alvarez et al , transaminase elevation was seen in 90% of jaundiced and in 5% of non-jaundiced patients; ALP elevation was seen in 100% of jaundiced and in 60% of non-jaundiced patients. [1] In a series by Essop et al ., transaminase elevation was seen in 78%, ALP elevation in 83% and GGT elevation in 77%. [14] In our study, raised ALP and GGT were common biochemical abnormalities in both hepatic and biliary TB, whereas high bilirubin was found only in biliary TB.
Imaging studies showed the presence of calcification in 5.2% cases of our series and in 0-50% in a previous series. [1],[17],[18] In our study, concomitant pulmonary TB was seen in 28.9% cases, whereas in the world literature it is described to vary from 10% to as high as 65%. [1],[15],[19] In our series, the diagnosis was suspected on abnormal LFT and imaging features. Although the findings of imaging are not diagnostic, they are often able to target the lesion for obtaining material for microbiological or histological diagnosis.
Among diagnostic features in our study, CG was present in more than 75% cases; more than 50% cases were positive for AFB smear/culture and more than 95% were positive for TB PCR. In a previous series, the presence of granulomatous hepatitis was seen in 25-80% of pulmonary TB. [20],[21] Low prevalence of hepatic granuloma in our series was probably due to the exclusion of miliary TB, in which prevalence of hepatic granuloma ranged from 75 to 100%. [22] In most series throughout the world, TB and sarcoidosis remain common etiologies being present in 2-55% and 1.9-54% cases, respectively, depending on countries where work has taken place and on the sources of data from pathological or clinical series. [4],[11],[12],[23],[24],[25],[26],[27],[28],[29],[30] Since most clinical and laboratory features are identical across cases with granulomatous hepatitis, differentiation between sarcoidosis and TB may be difficult at times, more so when there is presence of non-caseating epitheloid granuloma only. [11] Sarcoid granuloma are numerous, discrete, non-caseating, periportal in distribution, with asteroid bodies or Schaumann bodies, with thin rim of lymphocytes and with concentric hylanized scar in old granulomas. [11],[12],[31],[32] The presence of caseation and the tendency to coalesce seen in epitheloid granuloma favor TB as etiology. [11],[12],[14],[24] There is no zonal predilection for site of granuloma in TB. [11] TB granuloma is characterized by the presence of Langhans giant cells, destruction of reticulin framework and an irregular contour with a dense cuff of lymphocytes. [11],[12] In the world literature, 9-60% cases show the presence of AFB in biopsy smear/culture, more so with the presence of caseation. [11],[12],[14] AFB can be demonstrated by Ziehl-Neelsen staining ranging from 0 to 45% cases, [11],[14], [17,[24] but in up to 75% of patients with HIV infections without the presence of granulomas. [9] Mycobacterial cultures are positive in 0-43% of these cases, but more than 60% in miliary cases. [11],[14],[24] Recently described PCR assays have 88% sensitivity and 100% specificity for the detection of mycobacterial DNA on tissue specimen; however, it has its own limitations. [11],[17],[33]
Among the associated lesions on liver biopsy in our study, the presence of macrovesicular fatty infiltration was the commonest in patients with both HBTB and non-HBTB hepatobiliary involvement. None showed amyloidal deposits. In previously described series from India, the presence of fatty liver is seen in 8 to 27.6% [4],[12] and in 14-42% in various series from the world literature. [16],[20] Fatty liver in TB may be a result of malnutrition associated with TB or tubercular toxaemia, or may be an innocent bystander. [4] In a previous series, amyloidosis secondary to chronic TB inflammation was described in 0-10% cases. [4],[22],[34] Other non-specific changes in liver biopsy described in TB include focal hepatocellular necrosis, Kupffer cell hyperplasia, lymphohistiocytic aggregates, nodular regenerative hyperplasia, mild periportal fibrosis, or non-specific portal inflammation. [4],[12],[20]
In our series, 10 patients of HBTB with liver abscesses are described. Less than 100 cases of liver abscesses due to TB, including only 17 cases with primary involvement, are described in the world literature, including few patients with HIV infections. [5],[35],[36] In the two prospective reviews involving a total of 171 non-HIV cases of hepatic TB, no case of liver abscess was identified. [1],[15] It is important to differentiate these TB abscesses or pseudotumors from hepatocellular carcinoma or from amebic liver abscess. [5],[7] As in our study, initial diagnosis of abscess/mass on USG/CT needs to be ascertained finally by tissue biopsy/aspiration cytology under USG/CT/laparoscopic guidance before final diagnosis of TB liver abscess. [5],[7]
Biliary involvement in TB is uncommonly described. [3],[6],[37],[38],[39],[40] In a previous series, Stemmerman described TB of bile ducts in 3% of autopsies, [39] whereas a 10-year study from Brunei described four cases of biliary strictures due to TB. [6] There are few case reports of obstructive jaundice caused by TB lymphadenitis either at the porta hepatis (probably resulting from liver or gallbladder TB or hematogenous or lymphatic spread from portal vein territory) [41] or in the peripancreatic region (as a result of hematogenous or lymphatic spread from intra-abdominal organs). [37],[42] TB of gallbladder was reported in very few case reports from the world literature. [43],[44] In our series, we came across 18 cases with biliary TB, over a 6-year study period, affecting in decreasing order peripancreatic lymph nodes, biliary tree, hilar lymph nodes and gallbladder. In contrast to our series, in a previous series of 22 patients, 86% had proximal and 14% had distal biliary obstruction on cholangiography. [18] In our series, 36.8% cases had biliary obstruction with TB adenitis, as compared to 35% in a study by Alvarez et al . [1] Biliary affection can result (1) from primary TB involving biliary tract tuberculous strictures or cholangitis (resulting from rupture of CG into bile duct); (2) from rupture of periportal lymphatics into the adjacent walls of biliary ductules, (3) from secondary inflammation or compression related to periportal/peripancreatic tuberculous adenitis or pancreatic tuberculous mass; (4) from post-inflammatory stricture after treatment of TB; or (5) by compression from tuberculous pseudotumor. A major and the most crucial consideration is to rule out extra-hepatic malignant biliary obstruction, [6] as both the conditions present with a protracted course and identical clinical/laboratory/imaging features and diagnosis of TB offers cure to the patient; the tissue diagnosis becomes mandatory. As in our study, diagnosis can be established on the basis of histology/smear/culture of ERCP brushing/bile cytology of CT-guided or laparoscopic biopsies from lymph node/mass/stricture of biliary tree or of liver biopsies. [45]
Treatment with ATT in full dose is universally effective in HBTB despite initial abnormal LFT; dose modification as required in chronic liver disease is not required in these cases. None of the cases in our study had worsening in LFT following the start of ATT.
Other than those described above, TB can also result in portal vein thrombosis with resultant portal hypertension (few case reports), [11] in fulminant hepatic failure in the absence of any underlying liver disease (few case reports), [11],[46] or in congenital TB (less than 200 cases reported in the world literature, in which liver was involved in 80% cases). [47] All these varieties were not seen in our study.
In conclusion, HBTB presents with common symptoms and signs related to hepatobiliary tract. The non-specific nature of biochemical and imaging features can produce diagnostic confusion with many benign or malignant hepatobiliary tract diseases. Only histological demonstration of caseating confluent granuloma and/or microbiological demonstration of mycobacteria help in establishing the diagnosis. Hence, awareness of this condition is essential, since the disease is completely curable.
References | |  |
| 1. | Alvarez SZ, Carpio R. Hepatobiliary tuberculosis. Dig Dis Sci 1983;28:193-200. [PUBMED] |
| 2. | Chogle AR. Hepatic involvement in tuberculosis. J Assoc Physicians India 2000;48:181-2. [PUBMED] |
| 3. | Amarapurkar DN, Amarapurkar AD. Biliary tuberculosis. BHJ 1999;41:574-7. |
| 4. | Khosla SN, Chhabra HK, Mehrotra GC. Liver in abdominal tuberculosis. J Assoc Physicians India 1986;34:501-2. [PUBMED] |
| 5. | Chen HC, Chao YC, Shyu RU, Hsieh TY. Isolated tuberculous liver abscesses with multiple hyperechoic masses on ultrasound: A case report and review of literature. Liver Int 2003;23:346-50. |
| 6. | Kok KY, Yap SK. Tuberculosis of the bile duct: A rare cause of obstructive jaundice. J Clin Gastroenterol 1999;29:161-4. |
| 7. | Reed DH, Nash AF, Valabji P. Radiological diagnosis and management of a solitary tuberculous hepatic abscess. Br J Radiol 1990;63:902-4. |
| 8. | Gupta S, Meena HS, Chopra R. Hepatic Involvement in tuberculosis. J Assoc Physicians India 1993;41:20-2. [PUBMED] |
| 9. | Pergo V, Glatt AE, Roy V, Thelmo W, Dincsoy H, Raufman JP. Comparative yield of blood culture for fungi and mycobacteria, liver biopsy and bone marrow biopsy in the diagnosis of fever of undetermined origin in human immuno deficiency virus-infected patients. Arch Intern Med 1990;150:333-6. |
| 10. | Amarapurkar DN, Patel ND, Amarapurkar AD. Hepatic sarcoidosis. Indian J Gastroenterol 2003;22:98-100. [PUBMED] [FULLTEXT] |
| 11. | Valla DC, Benhamou JP. Hepatic granuloma and hepatic sarcoidosis. Clin Liver Dis 2000;4:269-285. [PUBMED] |
| 12. | Rajan A, Kar P. Hepatic granulomatosis. J Assoc Physicians India 2003;51:289-96. [PUBMED] |
| 13. | Maher D, Chaulet P, Spinaci S, Harries A. Treatment of tuberculosis: Guidelines for national programs. WHO Global tuberculosis programme. WHO/TB/97,220. |
| 14. | Essop AR, Posen JA, Hodkinsons JH, Segal I. Tuberculosis hepatitis: Clinical review of 96 cases. Q J Med 1984;53:465-77. |
| 15. | Maharaj B, Leary WP, Pudifin DJ. A prospective study of hepatic tuberculosis in 41 black patients. Q J Med 1987;63:517-22. [PUBMED] [FULLTEXT] |
| 16. | Hersch C. Tuberculosis of the liver: A study of 200 cases. S Afr Med 1964;38:857-63. |
| 17. | Alvarez SZ. Hepatobiliary tuberculosis. J Gastroenterol Hepatol 1998;13:833-9. [PUBMED] [FULLTEXT] |
| 18. | Maglinate DT, Alvarez SZ, Ng AC, Lapeρa JL. Patterns of calcifications and cholangiographic findings in hepatobiliary tuberculosis. Gastrointest Radiol 1988;13:331-5. |
| 19. | Guth AA, Kim U. The reappearance of abdominal tuberculosis. Surg Gynecol Obstet 1991;172:432-6. [PUBMED] |
| 20. | Korn RJ, Kellow WF, Heller P, Chomer B, Zimmerman H. Hepatic involvement in extrapulmonary tuberculosis: Histologic and functional characteristics. Am J Med 1959;27:60-71. |
| 21. | Bowry S, Chan CH, Weiss H, Katz S, Zimmerman HJ. Hepatic involvement in pulmonary tuberculosis. Respir Dis 1970;101:941-8. |
| 22. | Ullom JT. The liver in tuberculosis. Am J Med Sci 1909:137:694-9. |
| 23. | Klatskin G. Hepatic granuloma: Problems in interpretation. Ann NY Acad Sci 1976;278:427-32. [PUBMED] |
| 24. | Harrington PT, Gutierrez JJ, Ramirez-Ronda CH, Quiρones-Soto R, Bermúdez RH, Chaffey J. Granulomatous hepatitis. Rev Infect Dis 1982;4:638-55. |
| 25. | Sartin JS, Walker RC. Granulomatous hepatitis: A retrospective review of 88 cases at the Mayo Clinic. Mayo Clin Proc 1991;66:914-8. [PUBMED] |
| 26. | Guckian JC, Perry JE. Granulomatous hepatitis: An analysis of 63 cases and review of literature. Ann Intern Med 1966;65:1081-100. [PUBMED] |
| 27. | Neville E, Piyasena KH, James DG. Granuloma of the liver. Postgrad Med J 1975;51:361-5. [PUBMED] |
| 28. | Cunnigham D, Mills PR, Quigley EM, Patrick RS, Watkinson G, MacKenzie JF, et al . Hepatic granuloma: Experience over a 10-year period in the west of Scotland. Q J Med 1982;202:162-70. |
| 29. | Ferrell LD. Hepatic granuloma: A morphologic approach to diagnosis. Surg Pathol 1990;3:87-106. |
| 30. | Sabharwal BD, Malhotra N, Garg R, Malhotra V. Granulomatous hepatitis: A retrospective study. Indian J Pathol Microbiol 1995;38:413-6. |
| 31. | McCluggage WG, Sloan JM. Hepatic granuloma in Northern Ireland: A thirteen year review. Histopathology 1994;25:219-28. [PUBMED] |
| 32. | Devaney K, Goodman ZD, Epstein MS, Zimmerman HJ, Ishak KG. Hepatic sarcoidosis- clinicopathologic features in 100 patients. Am J Surg Pathol 1993;17:1272-80. [PUBMED] |
| 33. | Alcantra-Payawal DE, Mastumura M, Shiratori Y, Okudaira T, Gonzalez R, Lopez RA, et al . Direct detection of Mycobacterium Tuberculosis using polymerase chain reaction assay among patients with hepatic granuloma. J Hepatol 1997;27:620-7. |
| 34. | Jones K, Peck WM. Incidence of fatty liver in tuberculosis with special reference to tuberculous enteritis. Arch Intern Med 1994;74:371-4. |
| 35. | Amarapurkar DN, Chopra KB, Phadke, Sahni S, Prabhu SR, Kalro RH. Tuberculous abscess of the liver associated with HIV infection. Indian J Gastroenterol 1995;14:21-2. |
| 36. | Pottipati AR, Dave PB, Gumaste V, Vieux U. Tuberculous abscess of the liver in acquired immunodeficiency syndrome. J Clin Gastroenterol 1991;13:549-53. [PUBMED] |
| 37. | Murphy TF, Gray GF. Biliary tract obstruction due to tuberculous adenitis. Am J Med 1980;68:452-4. [PUBMED] |
| 38. | Fan ST, Ng IO, Choi TK, Lai EC. Tuberculosis of the bile duct: A rare cause of biliary stricture. Am J Gastroenterol 1989;84:413-4. [PUBMED] |
| 39. | Stemmerman M. Bile duct tuberculosis. Q Bull Sea View Hosp 1941;6:316-24. |
| 40. | Wee A, Nisson B, Wang TL, Yap I, Siew PY. Tuberculous pseudotumor causing biliary obstruction-report of a case with diagnosis by fine needle aspiration biopsy and bile cytology. Acta Cytol 1995;39:559-62. |
| 41. | Kohen MD, Altman KA. Jaundice due to a rare cause: Tuberculous lymphadenitis. Am J Gastroenterol 1973;59:48-53. [PUBMED] |
| 42. | Xia F, Poon RT, Wang SG, Bie P, Huang XQ, Dong JH. Tuberculosis of pancreas and peripancreatic lymph nodes in immunocompetent patients: Experience from China. World J Gastroenterol 2003;9:1361-4. [PUBMED] [FULLTEXT] |
| 43. | Ben RJ, Young T, Lee HS. Hepatobiliary tuberculosis presenting as a gall bladder tumor. Scand J Infect Dis 1995;27:415-7. [PUBMED] |
| 44. | Wang CT. Hepatobiliary tuberculosis. Chi J Tuberc Respir Dis 1991;14:40-1. |
| 45. | Bearer EA, Savides TJ, McCutchan JA. Endoscopic diagnosis and management of hepatobiliary tuberculosis. Am J Gastroenterol 1996:91;2602-4. |
| 46. | Sharma SK, Shamim SQ, Bannerjee CK, Sharma BK. Disseminated tuberculosis presenting as massive hepatosplenomegaly and hepatic failure. Am J Gastroenterol 1981;76:153-6. [PUBMED] |
| 47. | Cantwell MF, Shehab ZM, Costello AM, Sands L, Green WF, Ewing EP Jr, et al . Brief report: Congenital tuberculosis. N Engl J Med 1994;330:1051-4 [PUBMED] [FULLTEXT] |

Correspondence Address: Nikhil D Patel Jivandeep Hospital, Station Road, Anand 388 001, Gujarat India
  | 4 |
DOI: 10.4103/0377-4929.41644 PMID: 18603675
[Figure 1]
[Table 1], [Table 2], [Table 3] |
|
| This article has been cited by | | 1 |
Persistent port-site sinus in a patient after laparoscopic cholecystectomy: Watch out for gallbladder tuberculosis |
|
| Mansoor, T., Rizvi, S.A.A., Khan, R.A. | | Hepatobiliary and Pancreatic Diseases International. 2011; 10(3): 328-329 | | [Pubmed] | | | 2 |
Biliary Tract Tuberculosis—a Diagnostic Dilemma |
|
| Mahendran Govindasamy, Thiagarajan Srinivasan, Vibha Varma, Naimish Mehta, Amitabh Yadav, Vinay Kumaran, Samiran Nundy | | Journal of Gastrointestinal Surgery. 2011; | | [VIEW] | | | 3 |
Granulomatous gall bladder: A surgico-pathological challenge |
|
| Khan, R., Vasenwala, S.M., Arif, S.H., Harris, S.H. | | Annals of Saudi Medicine. 2010; 30(3): 244 | | [Pubmed] | | | 4 |
Pseudotumoral hepatic tuberculosis with pericardial abscess |
|
| Mutreja, D., Nangia, R., Mishra, P. | | Indian Journal of Pathology and Microbiology. 2010; 53(4): 763-766 | | [Pubmed] | | | 5 |
The nodular form of hepatic tuberculosis: Contrast-enhanced ultrasonographic findings with pathologic correlation |
|
| Cao, B.-S., Li, X.-L., Li, N., Wang, Z.-Y. | | Journal of Ultrasound in Medicine. 2010; 29(6): 881-888 | | [Pubmed] | | | 6 |
Tuberculous liver abscesses and venous thromboembolism - An unusual association |
|
| Gowrinath, K., Magazine, R., Bairy, I., Chawla, K., Shenoy, V. | | Respiratory Medicine CME. 2010; 3(4): 276-278 | | [Pubmed] | | | 7 |
Primary hepatic tuberculosis in an immunocompetent patient: The great mimic |
|
| Kibria, R., Gilani, S., Ali, S.A., Barde, C.J. | | Journal of Gastrointestinal and Liver Diseases. 2009; 18(3): 386-387 | | [Pubmed] | | | 8 |
Jane Austen and Addisonæs disease: An unconvincing diagnosis |
|
| White, K.G. | | Medical Humanities. 2009; 35(2): 98-100 | | [Pubmed] | |
|
|
 |
 |
|
|
|
|
|
|
| Article Access Statistics | | | Viewed | 6834 | | | Printed | 174 | | | Emailed | 6 | | | PDF Downloaded | 650 | | | Comments | [Add] | | | Cited by others | 8 | | |
|

|