LGCmain
Indian Journal of Pathology and Microbiology
Home About us Instructions Submission Subscribe Advertise Contact e-Alerts Ahead Of Print Login 
Users Online: 243
Print this page  Email this page Bookmark this page Small font sizeDefault font sizeIncrease font size
IJPM is coming out with a Special issue on "Genitourinary & Gynecological pathology including Breast". Please submit your articles for these issues


 
  Table of Contents    
LETTER TO EDITOR  
Year : 2011  |  Volume : 54  |  Issue : 2  |  Page : 420-421
A novel FRET probe-based approach for identification, quantification, and characterization of occult HCV infections in patients with cryptogenic liver cirrhosis


1 Bhopal Memorial Hospital and Research Centre, Bhopal; Division of Translational Research, Tata Memorial Centre, ACTREC, Navi Mumbai, India
2 Bhopal Memorial Hospital and Research Centre, Bhopal, India

Click here for correspondence address and email

Date of Web Publication27-May-2011
 

How to cite this article:
Bhargava A, Punde R, Varshney S, Pathak N, Mishra PK. A novel FRET probe-based approach for identification, quantification, and characterization of occult HCV infections in patients with cryptogenic liver cirrhosis. Indian J Pathol Microbiol 2011;54:420-1

How to cite this URL:
Bhargava A, Punde R, Varshney S, Pathak N, Mishra PK. A novel FRET probe-based approach for identification, quantification, and characterization of occult HCV infections in patients with cryptogenic liver cirrhosis. Indian J Pathol Microbiol [serial online] 2011 [cited 2019 Dec 15];54:420-1. Available from: http://www.ijpmonline.org/text.asp?2011/54/2/420/81609


Sir,

Cryptogenic cirrhosis (CC) defined as cirrhosis due to unidentified causes is often associated with the increased risk of developing hepato-cellular carcinoma (HCC). [1],[2] Although, manifestation of CC has been attributed to hepatitis C virus (HCV) infection, but due to the lack of highly sensitive technique for detection of HCV RNA in liver, the disease etiology is not clearly understood. [3] In addition, dilemma of whether patients with CC could harbor HCV in the liver similar to occult HCV infections (OHCI) still persists. OHCI are defined as cases negative for anti-HCV antibodies and HCV RNA in blood but positive for HCV RNA in liver. [4] The assessment of OHCI in CC patients might have a critical implication in the management of this deadly disease. Therefore, our study aimed to investigate the presence of OHCI in liver biopsies of CC patients using a novel fluorescence resonance energy transfer (FRET) hybridization-based probe technology.

The study was approved by the Institutional Review Board and informed consent was obtained from all individuals included in the study. The study comprised three groups---group A (n=10) comprised anti-HCV antibodies and serum HCV RNA negative CC patients; group B (n=10) included anti-HCV antibody and serum HCV RNA-positive patients; group C (n=10) consisted of age and gender matched healthy controls. Liver biopsies from group A and EDTA blood from group B and C was collected and HCV RNA was isolated through RNeasy Mini Kit and QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), following manufacturer's instructions. Isolated RNA was subjected for cDNA synthesis using Sensiscript RT Kit (Qiagen, Hilden, Germany) along with suitable primers (5´-CCCAACACTACTCGCCTA-3´; nucleotides 269 to 252). cDNA was then amplified and detected using Light Cycler 2.0 (Roche Applied Sciences, Mannheim, Germany) using appropriate primers and probes. The sequences used were forward primer HCV SF2 (5´GTGCAGCCTCCAGGACCCCC), reverse primer NAR3 (5´CCCTATCAGGCAGTACCACAA), FRET anchor probe HCVG-flourescein isothiocyanate (5´-GCCATAGTGGTCTGCGGAACCGGT); 5´-LCRed640 (GTACACCGGAATTGCCAGGA-phosphate-3´).

A positive fluorescence signal was detected in 3 out of 10 samples of group A (mean viral load 1.2 × 10 2 copies/mL) and in all the subjects of group B (mean viral load 5.8 × 10 4 copies/mL) indicating the presence of HCV RNA in these samples [Figure 1], further, genotype 3 was identified as the infecting genotype in all the positive cases. However, no false positive result was observed as no HCV RNA was detected in group C.
Figure 1: Real-time PCR analysis for occult hepatitis c virus in liver biopsy specimens of cryptogenic cirrhosis patients

Click here to view


In conclusion, it is a unique attempt to find out the presence of OHCI in the liver tissues of the patients with CC by applying FRET hybridization technology. Understanding the fact that patients with CC with OHCI are at increased risk of developing HCC, early specific identification of these cases using advanced and novel technologies is of great importance for the mankind. Such studies will not only be helpful in understanding the disease etiology of CC but also reveal usefulness of applying novel technologies in identifying the OHCI.


   Acknowledgements Top


The authors gratefully acknowledge Bhopal Memorial Hospital Trust for financial support and Mr. Naveen Kumar Khare for necessary technical assistance.

 
   References Top

1.Giannini EG, Marabotto E, Savarino V, Trevisani F, Di Nolfo MA, Del Poggio P, et al. Hepatocellular carcinoma in patients with cryptogenic cirrhosis. Clin Gastroenterol Hepatol 2009;7:580-5.   Back to cited text no. 1
    
2.Guerrero-Preston R, Siegel A, Renz J, Vlahov D, Neugut A. HCV Infection and Cryptogenic Cirrhosis are Risk Factors for Hepatocellular Carcinoma Among Latinos in New York City. J Community Health 2009;34:500-5.  Back to cited text no. 2
    
3.Geller SA, Nichols WS, Rojter SE, Chan RC, Petrovic LM, Vierling JM, et al. Hepatitis C virus is not recoverable from liver tissue in cryptogenic cirrhosis: Failure to identify hepatitis C virus-RNA using reverse transcription-mediated polymerase chain reaction. Hum Pathol 1996;27:1161-5.  Back to cited text no. 3
    
4.Carreño V. Occult hepatitis C virus infection: A new form of hepatitis C. World J Gastroenterol 2006;12:6922-5.  Back to cited text no. 4
    

Top
Correspondence Address:
Pradyumna K Mishra
Division of Translational Research, Tata Memorial Centre, ACTREC, Kharghar, Navi Mumbai - 410 210
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0377-4929.81609

Rights and Permissions


    Figures

  [Figure 1]

This article has been cited by
1 Translation research in molecular disease diagnosis: Bridging gap from laboratory to practice
Mishra, P.K., Raghuram, G.V., Bhargava, A., Pathak, N.
Journal of Global Infectious Diseases. 2011; 3(2): 205-206
[Pubmed]
2 Occult hepatitis C virus elicits mitochondrial oxidative stress in lymphocytes and triggers PI3-kinase-mediated DNA damage response
Bhargava, A., Raghuram, G.V., Pathak, N., Varshney, S., Jatawa, S.K., Jain, D., Mishra, P.K.
Free Radical Biology and Medicine. 2011; 51(9): 1806-1814
[Pubmed]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
    Email Alert *
    Add to My List *
* Registration required (free)  


    Acknowledgements
    References
    Article Figures

 Article Access Statistics
    Viewed1976    
    Printed62    
    Emailed0    
    PDF Downloaded77    
    Comments [Add]    
    Cited by others 2    

Recommend this journal