Indian Journal of Pathology and Microbiology
Home About us Instructions Submission Subscribe Advertise Contact e-Alerts Ahead Of Print Login 
Users Online: 2251
Print this page  Email this page Bookmark this page Small font sizeDefault font sizeIncrease font size
IJPM is coming out with a Special issue on "Genitourinary & Gynecological pathology including Breast". Please submit your articles for these issues


 
  Table of Contents    
ORIGINAL ARTICLE  
Year : 2012  |  Volume : 55  |  Issue : 3  |  Page : 352-356
Colonization of hospital water systems by Legionella pneumophila, Pseudomonas aeroginosa, and Acinetobacter in ICU wards of Tehran hospitals


1 Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran
2 Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran, Iran
3 Bacteriology, Faculty of Medical Sciences, Tarbiat Modares University, Tehran; Pediatric Infectious Diseases Research Center, Tehran University of Medical Sciences, Tehran, Iran

Click here for correspondence address and email

Date of Web Publication29-Sep-2012
 

   Abstract 

Background: Nosocomial infection caused by non-Enterobacteriaceae gram negative bacteria (GNB-NE) is increasing in intensive care units (ICU). Aim: The objective of this study was to determine whether potable water in ICU wards at Tehran hospitals is contaminated with L. pneomophila, P. aeroginosa and Acinetobacter spp. Materials and Methods: A total of 52 water samples from shower bath and taps water in seven hospitals of Tehran were collected. The water sample concentrated by filtering through millipore cellulose filters and cultured on BCYE agar and tryptic soya agar media. The presence of Legionella pneumophila was confirmed by real time PCR assay using primers-probe designed for the mip gene. Results: Legionella pneumophila, Pseudomonas aeroginosa and Acinetobacter were isolated from 5 (9.6%), 6 (11.4%) and 1 (1.8%) of the hospital water systems, respectively. This study demonstrated the presence of Legionella, Pseudomonas and Acinetobacter in water system in ICU wards of different hospitals in Tehran. Conclusions: Hot water from shower heads could be a potential source of infection for Legionella pneumophila. Water was also proved to contain Pseudomonas aeruginonsa, the main GNB-NE causing nosocomila pneumonia at Tehran hospitals. Care should be taken concerning cleanliness and decontamination of water supplies at ICUs for pathogenic organisms.

Keywords: Acinetobacter, hospital water, ICU wards, Legionella pneumophila, P. aeroginosa

How to cite this article:
Yaslianifard S, Mobarez AM, Fatolahzadeh B, Feizabadi MM. Colonization of hospital water systems by Legionella pneumophila, Pseudomonas aeroginosa, and Acinetobacter in ICU wards of Tehran hospitals. Indian J Pathol Microbiol 2012;55:352-6

How to cite this URL:
Yaslianifard S, Mobarez AM, Fatolahzadeh B, Feizabadi MM. Colonization of hospital water systems by Legionella pneumophila, Pseudomonas aeroginosa, and Acinetobacter in ICU wards of Tehran hospitals. Indian J Pathol Microbiol [serial online] 2012 [cited 2019 Jun 19];55:352-6. Available from: http://www.ijpmonline.org/text.asp?2012/55/3/352/101743



   Introduction Top


Each year, more than 2 million nosocomial infections occur in as many as 10% of all hospitalized patients, causing significant morbidity and mortality in the United States. These infections tend to happen more commonly in immunecompromised patients.≠[1] The ability of microbes to survive in hospital water reservoir was described more than 30 years ago, and numerous studies have confirmed hospitals water as a source of nosocomial infection. [1],[2]

Nosocomial infection develops 48 h after hospital admission or during 48 h after being discharged from hospital. Patients admitted to the ICU have been shown to be at high risk of acquiring nosocomial infection with a prevalence rate as high as 30%. [1],[3]

Nosocomial pneumonias account for 20%--45% of all hospital acquired infections and P. aeruginosa was causative in 20% of these pneumonias that could be related to water sources. [4] Trautmann et al. found that 5 of 17 patients in surgical ward (29%) were infected with P. aeruginosa genotypes that were identical to isolates from tap water. [2]

Legionella is an opportunistic pathogen with widespread distribution in the environment. Legoinella pneumophila, particularly strains within serogroups 1 and 6, is known as causative of both community acquired (CAP) and hospital associated pneumonia (HAP). [5],[6] Transmission to humans occurs through inhalation of aerosols generated from an environmental source. Several reports have demonstrated that the major sources for Legionnaires' disease (LD) are the potable water systems of large buildings including hospitals, nursing home, and hotels. [7]

In the population, the case fatality rate for legionellosis ranges from 10% to 15%.≠[8] However, the mortality can increase to 80% in hospital-acquired legionellosis, particularly in immunosuppressed patients who did not receive appropriate antibiotics. Risk factors for mortality include virulence of the involved strain, delay in antibiotic therapy, and degree of immunosuppression. [9] Moreover, certain strain described as Legionella like amoeba pathogens (LLAPs) cannot grow on Legionella selective culture media. [5]

Other species not belonging to Enterobacteriaceae may be a cause of nosocomial infections, mainly in immune-compromised patients. That may happen by transmission of these bacteria through drinking, inhaling droplet aerosol or by dermal exposure. The most important of these bacteria is P. aeruginosa that is the third most common agent responsible for hospital-acquired infections. Outbreaks caused by this organism have been reported in various locations such as adult intensive care units (ICUS), neonatal ICUs, medical wards, hematology units and burns units by environmental sources of transmission such as contaminated water or via the hands of healthcare workers. [10],[11] Pulmonary and bloodstream infections caused by P. aeruginosa are associated with momentous morbidity and with mortality rates of up to 40%-50%. [12]

Acinetobacter spp. play a significant role in the colonization and infection of patients admitted to hospitals and implicated in a variety of nosocomial infections, including bacteremia, urinary tract infection, and secondary meningitis, but their major role is as agent of nosocomial pneumonia, in patients admitted to ICUs. Outbreaks with mortality rate of 30%--75%, of nosocomial pulmonary infection caused by Acinetobacter spp. in ICUs have been reported.

The variety of potential sources of contamination or infection with Acinetobacter spp. in the hospital environment makes control of outbreaks caused by these organisms one of the most difficult challenges in infection control. [13]

The present study was to assess the degree of contamination of potable water from different source of water supply systems in seven hospitals, with Legionella and not belonging to the family Enterobacteriaceae (GNB-NE). [14]


   Materials and Methods Top




During July2010--February 2011, 52 water samples of hospitals water system were aseptically collected in the 1.5 l brand new sterile plastic bottles. These samples were taken from hot and cold different outlets (faucets: 14, showerheads: 28 and drinking water: 10) of ICU wards at 7 hospitals (A-B-C-D-E-F-G) water supply systems.

Processing of Samples

Water samples were examined for the presence of: (a) Legionella (b) non-fastidious Gram-negative bacteria not belonging to the Enterobacteriaceae family (GNB-NE).

For recovery of Legionella, water samples of 1000 ml volume were filtered through Cellulose nitrate membrane filters with a pore size of 0.45 μm (Sartorius AG, Goettingen, Germany). Membranes were broken into small pieces while they were inside the 100 ml sterile plastic container with 50 ml original filtered water. This container was shaken at 37 °C for 30 min to release the bacteria from filter to filtered water, and then 1 ml was taken from each container and treated by heating at 50 °C for 30 min to inactivate the organisms other than Legionella spp. [15] After treatment, 100 μl of each water sample was inoculated on a BCYE (Becton, Dickinson and Company, MD, USA) medium supplemented with glycine, vancomycin, cyclohexamide, and polymyxin B (GVPC) and finally placed on the BCYE agar. The plates were incubated under microaerophillic conditions at 35 °C (90% humidity, 3% of CO2) for 7 days. [15]

The Gram negative rods or coccobacilli were identified as Legionella if they failed to grow on blood agar and showed positivity in catalase and oxidase tests. [16] direct fluorescent antibody kit (Prolab, Texas, USA) was used to determine the serogroup 1 of Legionella pneumophila from other serogroup.

To recover GNB-NE, 100 ml volume of water samples each were filtered through cellulose filters 0.45 μm (Sartorius AG, Goettingen, Germany), and placed on the tryptic soya agar medium. [14]

DNA Extraction from Legionella pneumophila and real time PCR assay

We used phenol chloroform method for DNA extraction as described previously. [17] the mip gene encodes a 24 kDa protein that promotes the entry of bacteria into macrophages and amoeba. It has enough conserved sequence to be used for discrimination of Legionella pneumophila Scientific Name Search  from other species of this genus. [18],[19] The following primers and probes of mip gene used in real time PCR. [19]

F: GTATCCGATTTTCCGGGTTT

R: TTTGATGGCAAAGCGTACTG

P: JOE_CAACGCCTGGCTTGTTTTTG-BHQ1

Legionella pneumophila type strain NCTC 11192 was used as positive control in all experiments. The parameters that affect the real-time PCR were checked. The final optimized PCR reaction consists of 0.4 μM of each primer and probe, 3 μl dNTP (10 mM), 3mM MgCl 2 , 1 unit Taq polymerase (Metabion, Germany), 5 μM PCR buffer, and 5 μl of DNA template in total volume of 45 μl with double distilled water. The cycling program was adjusted as follows: initial denaturation at 95 °C for 5 min followed by 40 cycles of 95 °C for 15 s, 60 °C for 35 s.

Setting the Threshold

Whenever the CT of 10 10 , 10 8 , and 10 6 standard dilution ,copies number were 13 ± 0.6, 18.9 ± 0.5, and 25.2 ± 0.2, respectively, the results of our study was acceptable according to the following formula: 2 (CT1-CT2) = fold difference in the amount of starting target. [20]

Verification of Specificity

To check the specificity of our primers and probes was used several gram positive and negative bacteria. [19] L. pneumophila NCTC 11192 and water were used as positive and negative control, respectively. Beta actin gene (primer and probe) was used as internal control with all samples to detect PCR inhibitor as recommended by Mehndiratta et al. [21] the human white blood cell DNA was used as external control.

Isolation and Identification of GNB-NE

The tryptic soya agar (Merck KGaA, Darmstadt, Germany,) was used for isolation of bacteria not belonging to Enterobacteriaceae family. The inoculated plates were incubated for 24 h at 37 °C. The grown colonies were counted and differentiated by biochemical test. To confirmed the identity of isolates as Pseudomonas aeruginosa, the membrane was placed on plates containing Pseudomonas selective agar Base (Cetrimide Agar, Merck, Germany). Colonies were identified if they grew at 42 °C and were positive in oxidase test. [14],[15]


   Result Top


Isolation and Identification of Legionella Strains

Of water 52 samples, 5 (9. 6%) were positive for Legionella pneumophila in real time PCR and 4 (7.8%) yielded growths in culture [Table 1]. The number of CFUs for L. pneumophila in positive culture were > 10 2 CFU /ml. Real time PCR counted > 10 3 copies/ml in culture positives. We also isolated two isolates of Legionella other than pneumophila that grew on GVPC agar. The results of real time PCR for these isolates were negative because mip gene is solely present in the Legionella pneumophila genome. All positive Legionella pneumophila isolate were separated from hot water of shower header samples. Two isolates of Legionella other than pneumophila (isolates C2 and E1) were recovered from hot water of shower header hot water facet (tap water) respectively.
Table 1: The result of positive Legionella pneumophila and Legionella nonpneumophila sample in culture and real time PCR. NG: No Growth, RTPCR: Real Time PCR, A-G: Hospitals number

Click here to view


Three isolates of Legionella pneumophila (A1, A2, and F1) belonged to serogroup 1 as determined by direct fluorescent antibody. The serogroup of the 4 th isolate (C1) was not identified as serogroup.

Isolation of (GNB-E) and GNB-NE in water samples

Gram-negative bacteria belonging to the Enterobacteriaceae family (GNB-E) were not found in the examined water samples. Seven GNB-NE species were isolated from the samples of water and these include six isolates of P. aeruginosa (samples A3, A4, B1, D1, E2, and E3) and one isolate of Acinetobacter spp. (sample D2). Of these positive samples, 2 (A3, E3) were collected from hot water of shower headers and the remainders were from tap water (faucet). The number of CFUs detected for P. aeruginos ranged from 50 to 300 per 100 ml of water. Acinetobacter spp. (20CFU/100 ml) was isolated from hot water faucets. Sample B1 was positive with L. pneuumophila and P. aeruginosa simultaneously.


   Discussion Top


Legionella pneumophila , Pseudomonas aeruginosa, and Acinetobacter baumanii can live in water or released from biofilm into the water stream and consequently produce an infectious risk to users. The agents of legionellosis and those of other nosocomial waterborne infections assign remarkable similarities, including (1) their presence and amplification in water reservoir (2) a strong association with water biofilms, [22] (3) growth requirements (4) a correlation between infection with these agents and construction activity, and (5) transmission of bacteria (aerosolization, ingestion, and contact). Like Legionella species, these bacteria (including Pseudomonas aeruginosa) have also been shown to live not only in biofilms but also inside free-living amoebae. These amoebae harbor the bacteria interior their cysts, giving them a microhabitat and protecting them from disinfectants. [1] P. aeruginosa has been found to be responsible for 10%-20% of HAIs in intensive care units, and confirmed this infections can be directly derived from the water distribution system. [23]

This report shows Legionella pneumophila exists in the water systems of ICUs at Tehran hospitals. Our result also demonstrated the importance of high temperature for growth of L. pneumophila. Correlation between the presence of Legionella in hot water system and the occurrence of legionelosis has previously been documented by several investigators. [24],[25] The concentration of Legionella in the water distribution systems of our hospitals exceeded the threshold limit value of 1000 (10 3 ) CFU/100 ml. Real time PCR detected > 10 2 -10 4 copies of target gene in culture positive samples with > 10 2 CFU /ml. That shows water of hot shower headers at ICUs was highly infected. These numbers are higher than previous reports from Germany and Italy where in part of the samples up to 10 3 -10 6 cfu/100 ml was found.

Three (75%) of the strains grown on GVPC agar belonged to serogroup 1, that shows predominant L. pneumophila, serogroup in Tehran hospitals was serogroup 1. Although the distribution of serotypes causing community-acquired or hospital-acquired Legionnaires' disease varies by geographic region. [26]

Real time PCR assay was proved to be a sensitive method for identification of L. pneumophila. Some samples such as B1 did not grow on the GVPC agar but gave positive results in real time PCR since this method can detect from amoeba too. Viable but noncultivable organism can also be detected by this method too. Our designed real time PCR assay showed high sensitivity (4/4, 100%), specificity (47/48, 97.9%), could detect 200 copies of target (the first standard dilution).

As much as 7 samples of water (13.2%) were contaminated with non Enterobacteriaceae Gram negative bacteria (GNB-NE). These yielded Psudomonas spp (n = 6, 11.4%) and Acinetobacter spp. (n = 1, 1.8%). Both of these organisms are opportunistic pathogens and endanger the life patients admitted in ICU wards of Tehran hospitals. [17]

The presence of Pseudomonas aeruginosa species in quantities equal to or exceeding 1 CFU per 100 ml of potable water is not permitted by Polish and international 16 sanitary regulations. In our positive Pseudomonas aeruginosa samples (A3, A4, B1, D1, and E2.E3) have high concentration 50--300 CFU per 100 ml that can be threatening for patients at ICUs of Tehran hospitals.

Both Legionella pneumophila and Pseudomonas aeruginosa, (1/8 %) were detected in sample B1. B1 sample have 251 copies/ml Legionella pneumophila and 300 CFU/100 ml Pseudomonas aeruginosa this coinfection can lead to reduce growth of Legionella pneumophila. Moreover, there have been frequent reports of high loads of Pseudomonas aeruginosa which is likely to have masked the presence of Legionella, leading to an underestimation in some cases. Many authors agree that different microbe species as well as high microbial loads can play an important role in limiting or even inhibiting the growth of Legionella. [15],[24]


   Conclusion Top


The present study demonstrated that we need decontamination of hospital water system, the use of sterile water in ICUs, detection of breaks in techniques by hospital staff, and water surveillance in outbreak investigations.

In our search only one sample contained low concentration of Acinetobacter spp. It suggests that there should be other sources for infection with this organism at Tehran Hospital as water does not look to be a major source of infection at ICU wards in Tehran.


   Acknowledgement Top


This work was supported by Tehran University of Medical Sciences (Project no. 9816).

 
   References Top

1.Anaissie EJ, Penzak SR, Dignani MC. The hospital water supply as a source of nosocomial infections. Arch Intern Med 2002;162:1483-92.  Back to cited text no. 1
[PUBMED]    
2.Trautmann M, Michalsky T, Wiedeck H, Radosavljevic V, Ruhnke M. Tap water colonization with Pseudomonas aeruginosa in a surgical intensive care unit (ICU) and relation to Pseudomonas infections of ICU patients. Infect Control Hosp Epidemiol 2001;22:49-52.  Back to cited text no. 2
[PUBMED]    
3.Shaikh JM, Devrajani BR, Shah SZ, Akhund T, Bibi I. Frequency, pattern and etiology of nosocomial infection in intensive care unit: An experience at a tertiary care hospital. J Ayub Med Coll Abbottabad 2008;20:37-40.  Back to cited text no. 3
[PUBMED]    
4.Richards MJ, Edwards JR, Culver DH , Gaynes RP. Nosocomial infections in medical intensive care units in the United States. National Nosocomial Infections Surveillance System. Crit Care Med 1999;27:887-92.  Back to cited text no. 4
[PUBMED]    
5.Diederen BM. Legionella spp. and legionnaires disease. J Infect 2008;56:1-12.  Back to cited text no. 5
[PUBMED]    
6.Waterer GW, Baselski VS, Wunderink RG. Legionella and community-acquired pneumonia: A review of current diagnostic tests from a clinician's viewpoint. Am J Med 2001;110:41-8.  Back to cited text no. 6
[PUBMED]    
7.Yu PY, Lin YE, Lin WR, Shih HY, Chuang YC, Ben RJ, et al. The high prevalence of Legionella pneumophila contamination in hospital potable water systems in Taiwan: Implications for hospital infection control in Asia. Int J Infect Dis 2008;12:416-20.  Back to cited text no. 7
[PUBMED]    
8.Department of public health. 2009 Annual Morbility Report: Leginelosis country of Los Angles Public Health, 2009, PP. 101-102.  Back to cited text no. 8
    
9.Sabria M, Yu VL. Hospital-acquired legionellosis: Solutions for a preventable infection. Lancet Infect Dis 2002;2:368-73.  Back to cited text no. 9
[PUBMED]    
10.Bert F, Maubec E, Bruneau B, Berry P, Lambert-Zechovsky N. Multi-resistant Pseudomonus ueruginosu outbreak associated with contaminated tap water in a neurosurgery intensive care unit. J Hosp Infect 1998;39:53-62.  Back to cited text no. 10
[PUBMED]    
11.Elaichouni A, Verschraegen G, Claeys G, Devleeschouwer M, Godard C, Vaneechoutte M. Pseudomonas aeruginosa serotype 012 outbreak studied by arbitrary primer PCR. J Clin Microbiol 1994;32:666-71.  Back to cited text no. 11
[PUBMED]    
12.Trautmann M, Lepper PM, Haller M. Ecology of Pseudomonas aeruginosa in the intensive care unit and the evolving role of water outlets as a reservoir of the organism. Am J Infect Control 2005;33:41-9.  Back to cited text no. 12
[PUBMED]    
13.Bergogne-Bérézin E, Towner KJ. Acinetobacter spp. as nosocomial pathogens: Microbiological clinical and epidemiological features. Clin Microbiol Rev 1996;9:148-65.  Back to cited text no. 13
    
14.Stojek NM, Szymanska J, Dutkiewicz J. Gram-negative bacteria in water distribution systems of hospitals. Ann Agric Environ Med 2008;15:135-42.  Back to cited text no. 14
    
15.Veronesi L, Capobianco E, Affanni P, Pizzi S, Vitali P, Tanzi ML. Legionella contamination in the water system of hospital dental settings. Acta Biomed 2007;78:117-22.  Back to cited text no. 15
    
16.Blyth CC, Adams DN, Chen SC. Diagnostic and typing methods for investigating Legionella infection. N S W Public Health Bull 2009;20:157- 61.  Back to cited text no. 16
    
17.Feizabadi MM, Majnooni A, Nomanpour B, Fatolahzadeh B, Raji N, Delfani S, et al. Direct detection of Pseudomonas aeruginosa from patients with healthcare associated pneumonia by real time PCR. Infect Genet Evol 2010;10:1247-51.  Back to cited text no. 17
    
18.Wilson DA, Yen-Lieberman B, Reischl U. Detection of Legionella pneumophila by real-time PCR for the mip gene. J Clin Microbiol 2003;41:3327-30.  Back to cited text no. 18
    
19.Nomanpour B, Ghodousi A, Babaei T, Jafari S, Feizabadi MM. Single tube real time PCR for detection of Streptococcus pneumoniae, Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella pneumophila from clinical samples of CAP. Acta Microbiol Immunol Hung 2012:59:171-84  Back to cited text no. 19
    
20.Fraga D, Meulia T, Fenster SD. Current Protocols Essential Laboratory Techniques. 2008;10.3.1-33.  Back to cited text no. 20
    
21.Mehndiratta M, Palanichamy JK, Ramalingam P. Fluorescence acquisition during hybridization phase in quantitative real-time PCR improves specificity and signal-to-noise ratio. Biotechniques 2008;45:625-6.  Back to cited text no. 21
    
22.Mulla SA, Revdiwala S. Assessment of biofilm formation in device-associated clinical bacterial isolates in a tertiary level hospital. Indian J Pathol Microbiol 2011;54:561-4.  Back to cited text no. 22
[PUBMED]  Medknow Journal  
23.Blanc DS, Blanc DS, Nahimana I, Wenger A, Bille J, Francioli P. Faucets as a reservoir of endemic Pseudomonas aeruginosa colonization/infections in intensive care units. Intensive Care Med 2004;30:1964-8.  Back to cited text no. 23
    
24.Cordes LG, Wiesenthal AM, Gorman GW, Phair JP, Sommers HM, Brown A, et al. Isolation of Legionella pneumophila from shower heads. Ann Intern Med 1981;94:195-7.  Back to cited text no. 24
    
25.Hosseini Doust R, Mohebati Mobarez A, Esmaiili D. Detection of legionella in hospital water supply using Mip Based Primers. J Biol Sci 2008;8:930-4.  Back to cited text no. 25
    
26.Erdogan H, Arslan H. Colonization of Legionella Species in Hotel Water Systems in Turkey. J Travel Med 2007;14:369-73.  Back to cited text no. 26
    

Top
Correspondence Address:
Mohammad Mehdi Feizabadi
Department of Microbiology, School of Medicine, Tehran University of Medical Sciences, Tehran
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0377-4929.101743

Rights and Permissions



 
 
    Tables

  [Table 1]

This article has been cited by
1 Cold air plasma to decontaminate inanimate surfaces of the hospital environment
Cahill, O.J., Claro, T., OśConnor, N., Daniels, S., Humphreys, H.
Applied and Environmental Microbiology. 2014; 80(6): 2004-2010
[Pubmed]
2 The "new settlers": Results of a bacteriological survey during the first 6-months operation period of an internal medicine ward in a tertiary hospital
Segal, G., Brom, A., Ramati, E.
American Journal of Infectious Diseases. 2013; 9(4): 136-141
[Pubmed]
3 Frequency of legionella Pneumophila in tap water and water of infant incubators in Guilan hospitals, Iran
Moghadam, M.A.J., Honarmand, H., Meshginshahr, S.A., Tehrani, B.S., Nojavan, M.
Journal of Mazandaran University of Medical Sciences. 2013; 23(98): 312-321
[Pubmed]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Email Alert *
    Add to My List *
* Registration required (free)  


    Abstract
   Introduction
    Materials and Me...
   Result
   Discussion
   Conclusion
   Acknowledgement
    References
    Article Tables

 Article Access Statistics
    Viewed3768    
    Printed97    
    Emailed3    
    PDF Downloaded157    
    Comments [Add]    
    Cited by others 3    

Recommend this journal