LGCmain
Indian Journal of Pathology and Microbiology
Home About us Instructions Submission Subscribe Advertise Contact e-Alerts Ahead Of Print Login 
Users Online: 996
Print this page  Email this page Bookmark this page Small font sizeDefault font sizeIncrease font size


 
  Table of Contents    
ORIGINAL ARTICLE  
Year : 2013  |  Volume : 56  |  Issue : 3  |  Page : 252-257
Differential diagnosis of cervical lymphadenitis mimicking malignancy due to tularemia: Our experiences


1 Department of Infectious Diseases and Clinical Microbiology, GATA Haydarpasa Training Hospital, Istanbul, Turkey
2 Department of Pathology, GATA Haydarpasa Training Hospital, Istanbul, Turkey
3 Department of ENT, GATA Haydarpasa Training Hospital, Istanbul, Turkey

Click here for correspondence address and email

Date of Web Publication24-Oct-2013
 

   Abstract 

Background: Tularemia is a disease caused by a Gram-negative coccobacillus Francisella tularensis. This bacterium may cause different types of clinical pictures owing to acquisition route and entrance site, such as ulceroglandular, oropharyngeal, glandular, pneumonic, typhoid and ocular forms. Oropharyngeal tularemia (OPT) is the most common form of tularemia in some regions. OPT may cause tonsillopharyngitis followed by cervical lymphadenopathies (LAPs). Without treatment LAP may persist for several months and may mimic other diseases causing cervical LAPs. Materials and Methods: A total of six cases of OPT, five male and one female, between 21 and 31 years old, diagnosed serologically and clinically recorded in GATA Haydarpasa Training Hospital were included in this study. Detailed story including the region they lived for last 6 months, their occupation, family and neighborhood story with similar complaints were obtained. Patient data were also obtained from manually written patients files and electronical patient file system. Formalin fixed paraffin embedded tissue blocks of all biopsy material were submitted for polymerase chain reaction (PCR) study for F. tularensis. Results: A total of six cases with head and neck mass following a story of tonsillopharyngitis admitted to different clinics including infectious diseases, ear-nose-throat and internal medicine in our tertiary care hospital. Physical examination revealed immobile, hard, conglomerated unilateral cervical lymphadenopathy in all cases. Histopathological examination revealed granulomatous inflammation in four cases. Acute suppurative inflammatory changes were also seen in two cases. Large necrotic areas mimicking casseifying necrosis were seen in two cases. PCR amplification of F. tularensis genom from isolated deoxyribonucleic acids was successful in five cases. Conclusion: Tularemia should be kept in mind in patients with tonsillopharyngitis not responding to penicillins and beta lactam antibiotics. Furthermore, persisting LAPs mimicking tumor with or without the story of previously experienced sore throat or tonsillopharyngitis in past few days or weeks should be evaluated for glandular or OPT. At this point, easily applicable serological tests such as tularemia micro-agglutination tests will confirm the diagnosis of OPT. However, if lymph node were already sampled to exclude especially malignancy or T cell lymphoma, tularemia PCR test may be used to make a certain diagnosis.

Keywords: cervical lymphadenitis, Francisella tularensis, malignancy, oropharyngeal tularemia

How to cite this article:
Turhan V, Berber U, Haholu A, Salihoglu M, Ulçay A. Differential diagnosis of cervical lymphadenitis mimicking malignancy due to tularemia: Our experiences . Indian J Pathol Microbiol 2013;56:252-7

How to cite this URL:
Turhan V, Berber U, Haholu A, Salihoglu M, Ulçay A. Differential diagnosis of cervical lymphadenitis mimicking malignancy due to tularemia: Our experiences . Indian J Pathol Microbiol [serial online] 2013 [cited 2020 Jun 4];56:252-7. Available from: http://www.ijpmonline.org/text.asp?2013/56/3/252/120381



   Introduction Top


Tularemia is a disease caused by a Gram-negative cocobasil Francisella tularensis. This bacterium may cause different types of clinical pictures due to acquisition route and entrance site of the microorganism, such as ulceroglandular, oropharyngeal, glandular, pneumonic, typhoid and ocular forms. However, clinical course mostly depends upon virulence of bacteria, degree of the systemic involvement and immune status of the patient other than entrance route. Thus, the disease caused by F. tularensis may cause an asymptomatic infection as well as acute sepsis or even death. Incubation period of the disease is mostly around 3-5 days (1-21 days). [1],[2] Oropharyngeal tularemia (OPT) is the most common form of tularemia in some regions. OPT may cause tonsillopharyngitis followed by cervical lymphadenopathies (LAPs). Initial symptoms of the disease may mimic upper respiratory tract infection, flu-like symptoms such as high fever, chills, headache, fatigue and weight loss. [1],[2],[3],[4] Without treatment, fever usually lasts for around 30 days; however chronic tiredness, weight loss and lymphadenopathy may persist for several months suggesting a malignant disease or tuberculosis (TB). With the presence of varying clinical forms and reported from increasingly large geographical areas, the disease has become an important clinical entity for physicians from different medical disciplines including, infectious disease (ID), ear-nose-throat (ENT), internal medicine (IM), chest diseases and also pathology. Although ulceroglandular tularemia is the most commonly reported form of the disease in most part of the world, OPT is increasingly reported from some certain geographic regions such as Eastern and Northern Europe, Balkanian countries and Turkey. In this study, we report six cases of OPT mimicking malignancy with their, clinical, histopathological and serological features.


   Materials and Methods Top


A total of six cases of OPT, five male and one female, between 21 and 31 years old, diagnosed serologically and clinically recorded in the department of ID of Gulhane Military Medical Academy Haydarpasa Training Hospital were included in the study. Ethics committee permission was obtained from IRB of our hospital. All cases admitted due to the story of fever and sore throat experienced for 15-90 days. From all cases, detailed story including the region they lived for last 6 months, their occupation, family and neighborhood story with similar complaints were obtained. Systemic physical examination was performed from different clinics including ID, ENT and IM. Whole blood count, routine biochemical tests, serologic tests for cytomegalovirus (CMV), Ebstein barr virus (EBV), human immunodeficiency virus (HIV), syphilis, toxoplasmosis, brucellosis, salmonellosis and urine analysis were performed. Since all cases also had persisting cervical LAPs, cervical ultrasonography and/or cervical computerized tomography were done. All cases were underwent nasopharynx punch biopsy and five of six underwent fine-needle aspiration biopsy (FNAB). Four cases were underwent lymph node (LN) biopsy. Three cases were underwent both biopsy and FNAB. Formalin fixed paraffin embedded (FFPE) tissue blocks of all biopsy material were submitted for polymerase chain reaction (PCR) study for F. tularensis. 10-μm-thick tissue sections were cut from FFPE tissues for each biopsy material and submitted to PCR study to investigate F. tularensis deoxyribonucleic acids (DNAs). DNA was isolated by using QIAamp DNA Mini Kit (Qiagen, USA). For PCR forward primers from 5' to 3' CCATATCACTGGCTTTGCTAGACTAGT and backward primers from 3' to 5' TGTTGGCAAAAGCTAAAGAGTCTAAA are used as previously described.


   Results Top


The cases with head and neck mass following a story of tonsillopharyngitis admitted to different clinics including ID, ENT and IM in our tertiary care hospital. Although all patients previously had antibiotic treatment with either penicillins or beta-lactam antibiotics at least 14 days, physical examination revealed immobile, hard, conglomerated unilateral cervical LAP in all cases. Although during the story of tonsillopharyngitis, fever was declared by all patients, no fever was recorded at admission. Screening tests for infections of acute or active herpes simplex virus, CMV, EBV, infectious mononucleosis, toxoplasmosis, brucellosis, syphilis and HIV were negative. Complete blood count tests were normal in all cases. Transaminase levels were normal in four cases; however two cases had increased level of aspartate aminotransferase and alanine aminotransferase. Other routine biochemical tests were normal. Clinical and laboratory findings were summarized in [Table 1] and [Table 2] respectively.
Table 1: Some demographical and clinical features of the patients

Click here to view
Table 2: Summary of the performed laboratory tests of cases

Click here to view


Histopathological examination of nasopharynx revealed non-specific chronic inflammatory changes. In one case, polymorphonuclear leucocytes (PMNL) were also seen [Figure 1].
Figure 1: Histological view of nasopharynx biopsy revealed infl ammatory changes. (a) Reacti ve lymphoid follicules (case 1, H and E, ×100). (b) Chronic infl ammati on (case 2, H and E, ×100). (c) PMNLs were also seen (case 3, H and E, ×200)

Click here to view
Histopathologic examination revealed granulomatous inflammation in four cases. Acute suppurative inflammatory changes were also seen in two cases. Large necrotic areas mimicking casseifying necrosis were seen in two cases [Figure 2]. Cytological examination of FNAB was varying from case to case and necrotic background material, PMNL, lymphocytes and histiocytes were seen in general [Figure 3]. In one case, ulcers on tonsilla and reactive hyperplasia with non-necrotizing granulomatous foci in draining LN were seen [Figure 4]. PCR amplification of F. tularensis genom from isolated DNAs were successful in five cases [Figure 5].
Figure 2: Necrotizing and non-necrotizing granulomatous inflammation were seen in aff ected lymph nodes. (a) Non-necrotizing granulomatous inflammation (case 2, H and E, ×100). (b and c) Large necrotic areas surrounded by granulomatous inflammati on (case 5, H and E, ×100). (d) Few giant cells were also seen (case 5, H and E, ×100). (e) Small granulomas without necrosis were seen in other areas (case 5, H and E, ×200). (f) small lymphoid follicle was discernible in areas without granulomatous inflammation (case 5, H and E, ×100)

Click here to view
Figure 3: Cytological examination of lymp nodes revealed mixt inflammatory cells including polymorphonuclear cells, lymphocytes and histiocytes (case 5)

Click here to view
Figure 4: Tonsillar ulcer (H and E, ×100) (a) and reactive lymph node hyperplasia (H and E, ×200) (b) with a non-necrotizing granulomatous inflammation focus (H and E, ×200) (c)

Click here to view
Figure 5: Gel electrophoresis demonstrating PCR amplification of Francisella tularensis deoxyribonucleic acids. 107 bp bands shows some of the positive samples

Click here to view



   Discussion Top


A prominent portion of the patients admitting to medical centers constitutes those having fever, sore throat and cervical mass. Especially observed in all age groups, cervical masses are clinically complicated and difficult issue requiring systematical approach to make a differential diagnosis. [6],[7] In the etiology, both infectious and non-infectious process such as malignancies makes the differential diagnosis more crucial. On the other hand, when evaluating the cervical masses, age of the patients should be considered. While inflammatory conditions are frequently seen in younger age groups, malignancies are more common in over forties. In the age group between 16 and 40 years old, also including our cases, the etiology of the cervical masses is similar to that of pediatric age group. Still inflammatory conditions should be remembered firstly in this group. [7]

Tularemia is an ID mostly seen in the Northern hemisphere. It is seen mostly in Scandinavian countries and North America. However, cases from many countries including Turkey, Spain, Kosova, Bulgaria, France, Germany, Poland, Switzerland and Russia have also been reported. [8],[9]

In addition to sporadic cases of ulceroglandular, glandular, typhoidal and pneumonic forms of tularemia, cases of OPT originated from contaminated water and coursing as epidemics have also become an important public health issue. [10]

In OPT, predominant symptom is severe throat pain with exudative pharyngitis or tonsillitis and ulcers. Such cases may mimic streptococcal tonsillo-pharyngitis, but there is no response to penicillins or betalactam antibiotics. Following febrile tonsillopharyngitis, cervical/parathyroid/retropharyngeal long-lasting lymphadenopathy may be seen. [1],[7],[9],[10]

LAPs caused by glandular or OPT may arise suspicion of malignancy. Those cases may undergo tissue biopsy or FNAB, when tularemia is not kept in mind. Histopathological or cytological examination may exclude malignancy. However, they may not be sufficient to differentiate infectious conditions. For instance, due to histopathological examination revealing casseifying granulomatous lymphadenitis may mislead to make a diagnosis of TB, especially in the regions where TB is endemic. [9] Pathologists identifying necrotizing granulomatous lymphadenitis with TB and clinicians not having sufficient microbiological laboratory test opportunities to exclude TB may play a role at this point. On the other hand, low ratios of culture and AARB positivity in true TBL are also important reason for over diagnosis of TB. [11]

Recently, tularemia especially the form of OPT with signs and symptoms related with head and neck regions has been gaining importance. Although it is rare, tularemia lymphadenopathy with unknown acquisition route may also be seen in endemic areas ("glandular tularemia"). [1] Because of their resemblance to neoplastic diseases such as lymphoma or metastatic tumors, fine needle aspiration for cytological examination or biopsy, either incisional or excisional, may be applied to these patients. Sometimes nasopharyngeal biopsy may be taken to exclude nasopharyngeal carcinoma and its metastasis. In our study, nasopharyngeal punch biopsies were taken from five of six cases. FNAB were applied all cases.

Excisional biopsy was applied to four cases. Histopathological examination revealed granulomatous inflammation with or without necrosis. This histologic features may also be seen some other diseases such as cat scratch disease, TB, sarcoidosis and histoplasmosis. Engin et al. reported clinical manifestations of the tularemia patients in a case series including 29 patients seen in an endemic area in Turkey. They found granulamatous lymphadenitis in three cases who underwent to lymp node biopsy. And they also detected the presence of "casefying necrotizing granulamatous reaction" in histopathological examinations of these three cases, which were misdiagnosed as T cell lymphoma (TCL), previously. [12]

When a case with cervical LAP consisted with glandular or OPT is seen, non-invasive diagnostic tests such as microoagglutination tests in blood samples may confirm the diagnosis. If low titer antibodies are detected in the endemic region, suspicion of tularemia may arise. Thus, tularemia PCR test in LN may confirm the diagnosis of tularemia. Samples from LN may be obtained by either biopsy or aspiration.

Briefly, since OPT may cause LAP mimicking tumor, invasive interventions, like biopsy and other numerous medical tests are performed. After histopathologic examination of LNs reveal necrotizing granulomatous inflammation, the patient may undergo unnecessary long-term anti-TB treatment. This situation may also be common in countries where routinely childhood Bacille Calmette-Guιrin immunization programs causing purified protein derivative positivity are continued.

In conclusion, tularemia should be kept in mind in patients with tonsillopharyngitis not responding to penicillins and beta lactam antibiotics. Furthermore, persisting LAPs mimicking tumor with or without the story of previously experienced sore throat or tonsillopharyngitis in past few days or weeks should be evaluated for tularemia either glandular or OPT. At this point, easily applicable serological tests like tularemia micro-agglutination tests will confirm the diagnosis of OPT. However, if LN were already sampled to exclude especially malignancy or TCL, tularemia PCR test may be used to make a certain diagnosis.

 
   References Top

1.Aydemir H. Differential diagnosis in tularemia. In: Gürcan ª, editor. Francisella tularensis ve Tularemi. Ýstanbul, Turkey: Nobel Týp Kitabevi; 2009. p. 245-55.  Back to cited text no. 1
    
2.Sanders CV, Hahn R. Analysis of 106 cases of tularemia. J La State Med Soc 1968;120:391-3.  Back to cited text no. 2
    
3.Ohara Y, Sato T, Fujita H, Ueno T, Homma M. Clinical manifestations of tularemia in Japan - Analysis of 1,355 cases observed between 1924 and 1987. Infection 1991;19:14-7.  Back to cited text no. 3
    
4.Simþek H, Taner M, Karadenizli A, Ertek M, Vahaboðlu H. Identification of Francisella tularensis by both culture and real-time TaqMan PCR methods from environmental water specimens in outbreak areas where tularemia cases were not previously reported. Eur J Clin Microbiol Infect Dis 2012;31:2353-7.  Back to cited text no. 4
    
5.Mitchell JL, Chatwell N, Christensen D, Diaper H, Minogue TD, Parsons TM, et al. Development of real-time PCR assays for the specific detection of Francisella tularensis ssp. tularensis, holarctica and mediaasiatica. Mol Cell Probes 2010;24:72-6.  Back to cited text no. 5
    
6.Byun SC, Kim DS. Clinical ýnvestigation of neck masses in children. Korean J Pediatr 1996;39:1429-42.  Back to cited text no. 6
    
7.Çýnar F. Tularemia in practice of ENT. In: Gürcan Þ, editor. Francisella tularensis ve Tularemi. Ýstanbul, Turkey: Nobel Týp Kitabevi; 2009. p. 245-55.  Back to cited text no. 7
    
8.Maurin M, Castan B, Roch N, Gestin B, Pelloux I, Mailles A, et al. Real-time PCR for diagnosis of oculoglandular tularemia. Emerg Infect Dis 2010;16:152-3.  Back to cited text no. 8
    
9.Haholu A, Salihoðlu M, Turhan V. Granulomatous lymphadenitis can also be seen in tularemia, not only in tuberculosis. Int J Infect Dis 2013;17:e283.  Back to cited text no. 9
    
10.Turhan V, Ardýç N, Þahinoðlu L, Beþirbellioðlu BA, Gedikoðlu S. A general view to tularemia cases in Turkey: On to a pure oropharyngeal type outbreak. Anatolian J Clin Invest 2007;1:71-7.  Back to cited text no. 10
    
11.Iwnetu R, van den Hombergh J, Woldeamanuel Y, Asfaw M, Gebrekirstos C, Negussie Y, et al. Is tuberculous lymphadenitis over-diagnosed in Ethiopia? Comparative performance of diagnostic tests for mycobacterial lymphadenitis in a high-burden country. Scand J Infect Dis 2009;41:462-8.  Back to cited text no. 11
    
12.Engin A, Altuntaº EE, Cankorkmaz L, Kaya A, Elaldi N, ªimºek H, et al . The first tularemia outbreak in the Sivas province: A review of 29 cases. Klimik Dergisi 2011;24:17-23.  Back to cited text no. 12
    

Top
Correspondence Address:
Vedat Turhan
Department of Infectious Diseases and Clinical Microbiology, GATA Haydarpasa Egitim Hastanesi, Enfeksiyon Hastaliklari, ve Klinik Mikrobiyoloji Servisi, 34668, Üsküdar, Istanbul
Turkey
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0377-4929.120381

Rights and Permissions


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5]
 
 
    Tables

  [Table 1], [Table 2]

This article has been cited by
1 Tularemia as a waterborne disease: a review
Aurélie Hennebique,Sandrine Boisset,Max Maurin
Emerging Microbes & Infections. 2019; 8(1): 1027
[Pubmed] | [DOI]
2 Tularemia presenting as suspected necrotic arachnidism
Heather F. Sateia,Michael T. Melia,Joseph Cofrancesco
Clinical Case Reports. 2017; 5(4): 497
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Email Alert *
    Add to My List *
* Registration required (free)  


    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed5078    
    Printed85    
    Emailed6    
    PDF Downloaded129    
    Comments [Add]    
    Cited by others 2    

Recommend this journal