LGCmain
Indian Journal of Pathology and Microbiology
Home About us Instructions Submission Subscribe Advertise Contact e-Alerts Ahead Of Print Login 
Users Online: 9854
Print this page  Email this page Bookmark this page Small font sizeDefault font sizeIncrease font size


 
  Table of Contents    
ORIGINAL ARTICLE  
Year : 2011  |  Volume : 54  |  Issue : 1  |  Page : 85-89
Conventional and molecular characterization of coagulase-negative staphylococcus in hospital isolates


Department of Microbiology, Armed Forces Medical College, Pune, Maharashtra, India

Click here for correspondence address and email

Date of Web Publication7-Mar-2011
 

   Abstract 

Background: During the last decade, coagulase-negative staphylococci (CoNS) have emerged as a major cause of nosocomial infections. They constitute a major component of the normal skin and mucosal microflora, and are particularly responsible for catheter- and medical device-related sepsis. They present unique problems in diagnosis and treatment of infections. Purpose: The present study has been designed to evaluate phenotypic and genotypic characteristics of CoNS among nosocomial isolates. Setting and Design: This study was carried out in a tertiary care hospital. Data from 150 samples collected from 73 hospitalized patients and 15 healthy volunteers between October 2003 and May 2005 were analyzed. Patients and Methods: A total of 100 CoNS strains responsible for sepsis or implant-associated infections and 50 saprophytic strains were studied. Invasive CoNS strains were selected on the basis of different colony morphologies, drug resistance patterns, and biofilm formation. The same criteria were used to select saprophytic isolates. Multiplex PCR was used to explore the ica, mecA, and atlE genes, which might contribute to the pathogenicity of CoNS and the formation of biofilms. Results: Most of the invasive strains that formed the biofilm were resistant to multiple antibiotics, with more than 80% resistant to methicillin. ica and mecA genes were detected significantly in pathogenic strains (chi-square test, P<0.0001) whereas atlE was ubiquitously amplified in all the strains. All those strains which had ica and mecA genes were resistant to multiple antibiotics and were positive for biofilm formation. Conclusion: These genetic markers thus appear to discriminate between potential invasive virulent and saprophytic strains of CoNS.

Keywords: Biofilm, coagulase-negative staphylococci, multiplex PCR, virulence

How to cite this article:
Sharma P, Lahiri KK, Kapila K. Conventional and molecular characterization of coagulase-negative staphylococcus in hospital isolates. Indian J Pathol Microbiol 2011;54:85-9

How to cite this URL:
Sharma P, Lahiri KK, Kapila K. Conventional and molecular characterization of coagulase-negative staphylococcus in hospital isolates. Indian J Pathol Microbiol [serial online] 2011 [cited 2022 Aug 11];54:85-9. Available from: https://www.ijpmonline.org/text.asp?2011/54/1/85/77331



   Introduction Top


Coagulase-negative staphylococci (CoNS) have long been regarded as nonpathogenic and dismissed as cultural contaminants, but their important role as pathogens and their increasing isolation from hospitalized patients have been recognized and studied in recent years. [1] During the last decade, Staphylococcus epidermidis and other CoNS have emerged as a major cause of nosocomial infection. [2] Infections caused by these organisms involving indwelling foreign bodies, catheters, and artificial devices have become more prevalent due to their increased usage in recent times. [3] These infections are characterized by their indolence, but may necessitate the removal of the catheter or the device. The resistance of infecting isolates to multiple antibiotics may further complicate therapy.

The pathogenicity of CoNS may rely on the presence or absence of certain genes that are involved in the virulence process. These are icagene (intercellular adhesin - operon - icaADBC), atlE gene which encodes the vitronectin-binding cell surface protein involved in primary attachment, and mecA gene that controls the synthesis of the additional penicillin-binding protein PBP2a in methicillin-resistant staphylococcus.

This present study was taken up for the rapid detection and identification of virulent coagulase- negative staphylococcal strains by conventional methods and multiplex PCR. The genetic background of strains collected from sepsis cases, and implant-related and nosocomial infections was compared with that of contaminating and healthy carriage strains.


   Patients and Methods Top


Between October 2003 and May 2005, 100 clinically significant strains of CoNS were collected from 73 patients hospitalized in our tertiary care hospital. Fifty saprophytic strains were collected from skin of 15 healthy volunteers and surface of table tops. Invasive strains were collected from following clinical groups:

(a) patients (n = 10) having fever and an indwelling central line, (b) patients (n = 18) with infected knee or hip prosthesis, (c) patients (n = 36) suffering from UTI and with an indwelling catheter, (d) patients (n = 2) with endopthalmitis, and (e) patients (n = 7) with a ventriculoperitoneal shunt, CSF shunt, pulmonary artery catheter tip, or on ventilator.

Identification of an Organism

Samples were cultured (BHI broth/blood agar/CLED) and after 24-h incubation the plates were examined for colony characteristics. Isolates were identified by colony characteristics, Gram stain, and catalase test. Bacitracin (0.04 U) and furazolidone (100 μg) susceptibilities were determined to exclude Micrococcus, Planococcus, and Stomatococcus spp. [4] Coagulase test (slide and tube) and mannitol fermentation were done to exclude Staphylococcus aureus and other coagulase-positive species. These tests were performed on all samples of staphylococcus as per standard procedures. [5]

Once the identity of the isolate was confirmed as CoNS, a test for slime production was done by the tube method. [6]

The antibiotic susceptibility testing was done using the Kirby-Bauer disc diffusion method as described by National Committee for Clinical Laboratory Standards (4th edition). ABST was performed on Muller-Hinton agar. The S. aureus ATCC 25923 strain was used as a control strain. The antibiotic discs (Hi Media, Mumbai, Maharashtra, India) used were ampicillin (10 μg), augmentin (20/10 μg), cefotaxime (30 μg), choramphenicol (30 μg), ciprofloxacin (5 μ g), clindamycin (2 μg), erythromycin (15 μg), gentamicin (10 μg), cotrimoxazole (1.25/23.75 μg), oxacillin (1-μg) and vancomycin (30 μg). Results were interpreted after 24 h of incubation at 35-37°C.

Nucleic Acid Extraction

A large colony of organisms was suspended in 10 μl of the TE buffer in an Eppendorf tube. This suspension was heated in a microwave oven seven times for 1 min each with an interval of 1 min in between. To this 100 μl of the NaI solution was added and the mixture was vortexed. Ten microliters of well-suspended silica beads was added and the solution was again vortexed and kept on ice for 10 min. DNA got absorbed on the silica. This was then centrifuged at 6000 rpm for 1 min which formed a pellet of silica to which DNA was attached. A total of 100 μl of the wash buffer was added to resuspend the pellet by vortexing. Centrifugation at 6000 rpm for 1 min was done again to form the pellet. The supernatant was then discarded and tubes were dried at 50°C. To elute DNA, the pellet was suspended in the 30 μl TE buffer by vortexing and incubated at 5°C for 15 min. The supernatant, which contained DNA, was then removed and stored at -20°C.

Amplification by Multiplex PCR

Multiplex PCR was finally put up for identifying genes: mecA, ica, and atlE. A 100-μl reaction was put up. In 100 μl of the master mix, 10 μl of the 10× Taq buffer (100 mM Tris, pH 8.4, 500 mM KCl, 25 mM MgCl 2 ), 3.2 μl of dNTPs, 25 pmol of each primer, 0.5 μl of Taq polymerase (3 U/μl, Invitrogen Life Technologies) were added. The final volume was made up to 100 μl by adding 66.3 μl sterile distilled water. To the master mix, 1 μl of the extracted DNA was added as template. PCR conditions were as follows: initial denaturation at 94°C for 2 min, followed by 30 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and extension at 72°C for 2 min, ending with a final extension at 72°C for 5 min. The sequence of forward and reverse primers (Bangalore Genei, Bengaluru, Karnataka, India) used for multiplex PCR (mecA, ica, and atlE genes) were as follows:

  1. ica(product size 546 bp)

    Forward ica- TTATCAATGCCGCAGTTGTC

    Reverse ica - GTTTAACGCGAGTGCGCTAT


  2. mecA(product size 310 bp)

    mecA1 - GTAGAAATGACTGAACGTCCGATAA

    mecA2 - CCAATTCCACATTGTTTCGGTCTAA


  3. atlE (product size 682 bp)

    Forward atlE - CAACTGCTCAACCGAGAACA

    Reverse atlE - TTTGTAGATGTTGTGCCCCA.


Amplification products were analyzed by gel (1.5%) electrophoresis [Figure 1].
Figure 1: Agarose gel electrophoresis showing results of gene amplification: 1 - Positive control; 2, 3, and 4 - clinical strains; M - molecular weight ladder; 5, 6 - saprophytic strains; 7 - negative control (D/W) atlE (682 bp), ica (546 bp), and mecA (310 bp), genes from top to bottom

Click here to view

   Results Top


Out of the 100 clinical strains, 36 were from urine, 27 from blood, 18 from pus, 10 from central lines, 4 from tracheal swabs, 2 from vitreous fluid, and 1 each from the ventriculoperitoneal shunt, cerebrospinal shunt, and pulmonary artery catheter tip.

In the present study, phenotypic markers like biofilm formation, ABST, and genotypic markers, namely, the presence of the ica operon and mecA gene discriminated between infectious and saprophytic strains.

Biofilm production, assessed by using the tube method, [6] was expressed by 61 out of 100 clinical strains and 2 out of 50 saprophytic strains.

Results of the ABST pattern shown by different clinical isolates are shown in [Table 1]. Most of the clinical isolates were multidrug resistant. In contrast, all the 50 saprophytic isolates were sensitive to all antibiotics. Eighty-eight percent clinical isolates were resistant to methicillin (oxacillin) but all were sensitive to vancomycin. With the oxacillin disc, strains of CoNS showing a zone of inhibition of 18 mm or more after 24 hs of incubation were considered methicillin sensitive and those with a zone of inhibition of 17 mm or less were considered methicillin resistant.
Table 1: ABST profile of 100 clinical isolates by the Kirby-Bauer method

Click here to view


Results of gene amplification by multiplex PCR are shown in [Table 2]. A total of 80% of clinical isolates expressed the mecA gene while only 5% saprophytic strains expressed the mecA gene. The primary mechanism of oxacillin resistance is mecA-mediated resistance. The ica gene was expressed by 58% clinical isolates while none of the saprophytic isolates expressed the ica gene. The atlE gene was ubiquitously amplified.
Table 2: Results of Gene amplification by multiplex PCR

Click here to view


Results of gene amplification in relation to the place of isolation are shown in [Table 3]. All the isolates from ICU expressed the mecA gene but only 88% expressed the ica gene.
Table 3: Results of gene amplification in relation to the place of isolation

Click here to view


Of the 59 CoNS strains found positive for the ica operon, 57 were found to be biofilm producers. All (61) but one biofilm-producing strain expressed the mecA gene. Antibiotic resistance was more frequent in isolates of CoNS found positive for ica operon.


   Discussion Top


The clinical significance of CoNS species continues to increase as strategies in medical practice lead to more invasive procedures. Hospitalized patients that are immunocompromised and/or suffering from chronic diseases are the most vulnerable to infection. Since CoNS are widespread on the human body and are capable of producing very large populations, distinguishing the etiologic agent(s) from contaminating flora is a serious challenge. For this reason, culture identification should proceed to the strain levels. A much stronger case can be made for the identification of a CoNS etiologic agent if the same strain is repeatedly isolated from a series of specimens as opposed to the isolation of different strains of one or more species. Strain identity initially can be based on colony morphology, and then one or more molecular approaches can be used to gain information on the genotype.

Many of the CoNS species are commonly resistant to antibiotics that are being indicated for staphylococcal infections, with the exception of vancomycin. In our study as shown in [Table 1], most of the clinical isolates were resistant to multiple antibiotics. Among the 100 clinical isolates, 88 (88%) were resistant to methicillin but all were sensitive to vancomycin. As such methicillin resistant is documented more often in disease-causing isolates than in colonizing isolates. [7] The widespread use of antibiotics in hospitals has provided a reservoir of antibiotic-resistant genes.

The main focus on mechanisms of pathogenesis has been related with foreign body infections and the role of specific adhesins and slime (biofilm) produced by CoNS. The interaction of bacteria with biomaterials has been suggested to have a crucial role in conditioning the progress of these severe nosocomial infections. [8] The existence of different bacterial molecules of adhesion has been increasingly documented. For staphylococcal species, two possible explanations of the ability to colonize artificial materials are the bacterial production of polysaccharide slime or the biofilm and the presence of adhesins for the host matrix proteins that, in vivo, are adsorbed onto the biomaterial surface. [9],[10]

In this study, the percentage of biofilm-forming clinical strains was 69% (69). However, Muller et al.[11] found 46% of their clinical strains to be positive for biofilms and Ziebuhr et al.[12] instead reported that 87% of S. epidermidis clinical isolates formed biofilms. All these biofilm-forming strains were resistant to multiple antibiotics. Our finding that the production of biofilms was associated with antibiotic resistance is consistent with findings of several previous studies; [13],[14] 2 out of the 50 saprophytic isolates, i.e., 4% did form biofilms. A possible explanation could be that, because the source of CoNS infectious strains is skin flora, the markers of pathogenicity like biofilms, which are wider among the infectious strains, are expected to be found in normal skin but with a low prevalence.

The mecA gene, which controls the synthesis of an additional penicillin-binding protein PBP2a in methicillin-resistant staphylococcus, was seen in 80% (80) clinical strains and 10% (5) saprophytic strains as shown in [Table 2]. The difference between invasive and saprophytic strains was statisstically significant for the presence of the mecA gene (P<0.0001). Our findings on mecA are similar to that of a study coated by CDC. [15] Of the 88 clinical strains that were resistant to methicillin, 80 expressed the mecA gene. All the 69 clinical isolates that formed the biofilm had the mecA gene. The lack of the mecA gene in biofilm negative phase variants suggests its possible role in pathogenicity.

Polysaccharide synthesis is mediated by the ica operon; it encodes an N-acetylglucosaminyl transferase enzyme that catalyzes the synthesis of the capsular polysaccharide (β-1,6-glucosaminoglycan) from N-acetylglucosamine. [16] The production of polysaccharide intercellular adhesin (PIA) is an important component in the process of biofilm formation, suggesting that the ica operon plays an important role in disease pathogenesis. Evidence for this comes from both animal models and clinical studies. The inactivation of icaA was reported to be associated with a decrease in the pathogenicity of a strain of S. epidermidis in two animal models of foreign body infection. [17],[18] The presence of the icaoperon was also found to be more common in S. epidermidis strains associated with disease than in carriage strains in four studies of human disease. [19],[20] Fifty-eight percent clinical strains and none of the saprophytic stains had the icagene [Table 2]. ica locus was detected significantly more in invasive strains than in saprophytic strains (P<0.0001). Our finding of 58% positivity of the ica gene is consistent with the finding of Noelle et al. [2] In their study, 68.2% of the clinical strains were positive for the ica gene. All the 58 clinical strains that expressed the ica gene were the one which formed biofilm, had the mecA gene, and were resistant to multiple antibiotics.

In this study, the atlE gene, which encodes a vitronectin-binding cell surface protein involved in primary attachment, was ubiquitously amplified in CoNS strains. Our finding that atlEwas ubiquitously amplified is consistent with the findings of a previous study by Noelle et al. [2] In that study too, all the clinical and saprophytic strains expressed the atlE gene. Although atlE was ubiquitously found in different groups of strains, the potential function of their products in virulence cannot be excluded.

Therefore, in this study, the presence of the ica operon and mecA gene appeared to be the best marker for discriminating between infectious and contaminating strains. Antibiotic resistance was more frequent in CoNS isolates found positive for the ica operon and mecA gene. All the ica gene-positive isolates were resistant to multiple antibiotics and out of 88 methicillin-resistant isolates, 80 had mecA gene. In addition, there was a significant correlation between the number of antibiotics to which a strain was resistant and biofilm production. An association between the clinical source of the strain and antibiotic resistance mirrored the association between biofilm production and antibiotic resistance. Strains derived from the blood of patients with clinical CoNS sepsis or central lines were on average resistant to more antibiotics than those derived from the skin of healthy controls. Antibiotic resistance, particularly β-lactam resistance, is probably an important selective force considering the high mecA gene carriage of CoNS blood isolates (77.7%). CoNS sepsis is increasingly caused by a limited number of predominant molecular CoNS types, i.e., those with mecA and icagenes.

In the present study, the mecA gene was found in 80% of invasive strains. Unexpectedly, the mecA gene was amplified from 62.9% and ica from 33.3% of strains isolated from OPD cases [Table 3]. These data suggest the presence of methicillin-resistant CoNS in the community, which reflects the dissemination of hospital strains or role of antibiotics and that antibiotic resistance is probably a major selective force. Molecular techniques for the detection of the gene sequences that encode the adhesion molecules could conveniently be applied in the study of prevalent adhesion mechanisms. From the clinical standpoint, elucidation of the main adhesive mechanisms in periprosthesis infections may help in developing preventive and therapeutic measures, such as antiadhesive coatings or antiadhesin drugs. [21],[22] We suggest that a study of the presence and expression of genes for adhesion molecules, such as the ica genes, may help in clarifying the relevance of the different adhesion mechanisms in the pathogenesis of infections associated with medical devices. It could also be of value in the development of new preventive and therapeutic measures. The presence of ica and mecA gene loci may further add to the clinical criteria used for the diagnosis of septicemia or catheter-related infections.

 
   References Top

1.Huebner J, Goldmann DA. Coagulase negative staphylococci: Role as pathogens. Annu Rev Med 1999;50:223-36.  Back to cited text no. 1
[PUBMED]  [FULLTEXT]  
2.Frebourg NB, Lefebvre S, Baert S, Lemeland JF. PCR based assay for discrimination between invasive and contaminating Staph. epidermidis strains. J Clin Microbiol 2000;38:877-80.   Back to cited text no. 2
[PUBMED]  [FULLTEXT]  
3.O'Gara JP, Humphreys H. Staphylococcus epidermidis biofilms: Importance and implications. J Med Microbiol 2001;50:582-7.  Back to cited text no. 3
[PUBMED]  [FULLTEXT]  
4.Kloos WE, Bannerman TL. Staphylococcus and Micrococcus. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of clinical microbiology. 7 th ed. Washington, D.C: American society for Microbiology; 1999. p.264-82.  Back to cited text no. 4
    
5.Collee JG, Fraser AG, Marmion BP, Simmons A, et al. In: Cruickshank R, Duguid JP, Swain RH, editors. Mackie and Mc Cartney Practical Medical Microbiology. 14 th ed. Edinburgh, Churchill Livingstone 1996.p247, 252-6.   Back to cited text no. 5
    
6.Christensen GD, Simpson WA, Bisno AL, Beachey EH. Adherence of slime producing strains of Staphylococcus epidermidis to smooth surfaces. Infect Immun 1982;37:318-26.  Back to cited text no. 6
[PUBMED]  [FULLTEXT]  
7.Archer GL. Alteration of cutaneous staphylococcal flora as a consequence of antimicrobial prophylaxis. Rev Infect Dis 1991;13:S805-9.   Back to cited text no. 7
[PUBMED]    
8.Francois P, Vaudaux P, Foster TJ, Lew DP. Host-bacteria interactions in foreign body infections. Infect Control Hosp Epidemiol 1996;17:514-20.  Back to cited text no. 8
    
9.Barth E, Myrvik QM, Wagner W, Gristina AG. In vitro and in vivo comparative colonization of Staphylococcus aureus and Staphylococcus epidermidis on orthopaedic implant materials. Biomaterials 1989;10:325-8.  Back to cited text no. 9
[PUBMED]    
10.Foster TJ, Mc Devitt D. Molecular basis of adherence of staphylococci to biomaterials. In: Bisno AL, Waldvogel FA, editors. Infection associated with indwelling medical devices. 2 nd ed. Washington, D.C: American Society for Microbiology; 1994. p. 31-43.  Back to cited text no. 10
    
11.Muller E, Takeda S, Shiro H, Goldmann D, Pier GB. Occurrence of capsular polysaccharide/adhesin among clinical isolates of coagulase-negative staphylococci. J Infect Dis 1993;168:1211-8.  Back to cited text no. 11
[PUBMED]  [FULLTEXT]  
12.Ziebuhr W, Heilmann C, Gotz F, Meyer P, Wilms K, Straube E, et al. Detection of the intercellular adhesion gene cluster (ica) and phase variation in Staphylococcus epidermidis blood culture strains and mucosal isolates. Infect Immun 1997;65:890-6.  Back to cited text no. 12
    
13.Deighton MA, Franklin JC, Spicer WJ, Balkau B. Species identification, antibiotic sensitivity and slime production of coagulase negative staphylococci isolated from clinical specimens. Epidemiol Infect 1988;101:99-113.  Back to cited text no. 13
[PUBMED]  [FULLTEXT]  
14.Kotilainen P, Nikoskelainen J, Huovinen P. Antibiotic susceptibility of coagulase negative staphylococci blood isolates with special reference to adherent slime-producing Staphylococcus epidermidis strains. Scand J Infect Dis 1991;23:325-32.  Back to cited text no. 14
[PUBMED]    
15.Hsueh PR, Chen ML, Sun CC, Chen WH, Pan HJ, Yang LS, et al. Antimicrobial drug resistance in pathogens causing nosocomial infections at a university hospital in Taiwan, 1981-1999. Emerg Infect Dis 2002;8:63-8.   Back to cited text no. 15
[PUBMED]  [FULLTEXT]  
16.Aricola CR, Baldassarri L, Montanaro L. Presence of ica A and icaD genes and slime production in a collection of staphylococcal strains from catheter associated infections. J Clin Microbiol 2001;39:2151-6.  Back to cited text no. 16
    
17.Rupp ME, Ulphani JS, Fey PD, Bartscht K, Mack D. Characterization of the importance of polysaccharide intercellular adhesin-hemagglutinin of Staphylococcus epidermidis in the pathogenesis of biomaterial-based infection in mouse foreign body infection model. Infect Immun 1999;67:2627-32.  Back to cited text no. 17
[PUBMED]  [FULLTEXT]  
18.Rupp ME, Ulphani JS, Fey PD, Mack D. Characterization of Staphylococcus epidermidis polysaccharide intercellular adhesin-hemagglutinin in the pathogenesis of intravascular catheter-associated infection in a rat model. Infect Immun 1999;67:2656-9.   Back to cited text no. 18
[PUBMED]  [FULLTEXT]  
19.Ziebuhr W, Heilmann C, Gotz F, Meyer P, Wilms K, Straube E, et al. Detection of the intercellular adhesion gene cluster (ica) and phase variation in Staphylococcus epidermidis blood culture strains and mucosal isolates. Infect Immun 1997;65:890-6.  Back to cited text no. 19
    
20.Galdbart JO, Allignet J, Tung HS, Ryden C, El Solh N. Screening for Staphylococcus epidermidis markers discriminating between skin-flora strains and those responsible for infections of joint prostheses. J Infect Dis 2000;182:351-5.  Back to cited text no. 20
    
21.An YH, Blair BK, Martin KL, Friedman RJ. Macromolecule surface coating for preventing bacterial adhesion. In: An YH, Friedmann RJ, editors. Handbook of bacterial adhesion: Principles, methods and applications. Totowa, NJ: Humana Press Inc; 2000. p. 609-25.  Back to cited text no. 21
    
22.Arciola CR, Montanaro L, Baldassarri L, Borsetti E, Cavedagna D, Donati ME. Slime production by staphylococci isolated from prosthesis-associated infection. New Microbiol 1999;22:337-41.  Back to cited text no. 22
    

Top
Correspondence Address:
Poonam Sharma
Department of Microbiology, Sri Guru Ramdas Institute of Medical Sciences & Research, Vallah, Amritsar - 143 006, Punjab
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/0377-4929.77331

Rights and Permissions


    Figures

  [Figure 1]
 
 
    Tables

  [Table 1], [Table 2], [Table 3]

This article has been cited by
1 The speciation and antimicrobial susceptibility pattern of coagulase negative Staphylococci in a tertiary care hospital in Mumbai
Monita Kulkarni, Shilpa Patil
IP International Journal of Medical Microbiology and Tropical Diseases. 2021; 6(4): 227
[Pubmed] | [DOI]
2 Effect of antibiotic prophylaxis on Coagulase-negative Staphylococcus virulence factor profiles in patients undergoing cataract surgery
Yolanda López,Margarita Samudio,Norma Fariña,Verónica Castillo,Sonia Abente,Martin M. Nentwich,Nilsa González-Britez,Florentina Laspina,Agustín Carron,Diógenes Cibils,Herminia Miño de Kaspar
International Ophthalmology. 2017; 37(4): 929
[Pubmed] | [DOI]
3 The response of human bacteria to static magnetic field and radiofrequency electromagnetic field
David P. E. Crabtree,Brandon J. Herrera,Sanghoon Kang
Journal of Microbiology. 2017; 55(10): 809
[Pubmed] | [DOI]
4 Molecular epidemiology of coagulase-negative Staphylococcus carriage in neonates admitted to an intensive care unit in Brazil
Yves Ternes,Juliana Lamaro-Cardoso,Maria Cláudia André,Vicente Pessoa,Maria Aparecida da Vieira,Ruth Minamisava,Ana Andrade,André Kipnis
BMC Infectious Diseases. 2013; 13(1): 572
[Pubmed] | [DOI]
5 Bacterial Contaminants of Bandage Contact Lenses Used After Laser Subepithelial or Photorefractive Keratectomy
Xiaowei Liu,Peng Wang,Andrew A. Kao,Yang Jiang,Ying Li,Qin Long
Eye & Contact Lens: Science & Clinical Practice. 2012; 38(4): 227
[Pubmed] | [DOI]



 

Top
 
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Email Alert *
    Add to My List *
* Registration required (free)  


    Abstract
    Introduction
    Patients and Methods
    Results
    Discussion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed6938    
    Printed283    
    Emailed6    
    PDF Downloaded318    
    Comments [Add]    
    Cited by others 5    

Recommend this journal