|
|
| Year : 2011 | Volume
: 54
| Issue : 2 | Page : 420-421 |
|
| A novel FRET probe-based approach for identification, quantification, and characterization of occult HCV infections in patients with cryptogenic liver cirrhosis |
|
|
Arpit Bhargava1, Ram Punde2, Subodh Varshney2, Neelam Pathak2, Pradyumna K Mishra1
1 Bhopal Memorial Hospital and Research Centre, Bhopal; Division of Translational Research, Tata Memorial Centre, ACTREC, Navi Mumbai, India
2 Bhopal Memorial Hospital and Research Centre, Bhopal, India
Click here for correspondence address and email
| Date of Web Publication | 27-May-2011 |
|
|
 |
|
How to cite this article:
Bhargava A, Punde R, Varshney S, Pathak N, Mishra PK. A novel FRET probe-based approach for identification, quantification, and characterization of occult HCV infections in patients with cryptogenic liver cirrhosis. Indian J Pathol Microbiol 2011;54:420-1 |
How to cite this URL:
Bhargava A, Punde R, Varshney S, Pathak N, Mishra PK. A novel FRET probe-based approach for identification, quantification, and characterization of occult HCV infections in patients with cryptogenic liver cirrhosis. Indian J Pathol Microbiol [serial online] 2011 [cited 2021 Jan 19];54:420-1. Available from: https://www.ijpmonline.org/text.asp?2011/54/2/420/81609 |
Sir,
Cryptogenic cirrhosis (CC) defined as cirrhosis due to unidentified causes is often associated with the increased risk of developing hepato-cellular carcinoma (HCC). [1],[2] Although, manifestation of CC has been attributed to hepatitis C virus (HCV) infection, but due to the lack of highly sensitive technique for detection of HCV RNA in liver, the disease etiology is not clearly understood. [3] In addition, dilemma of whether patients with CC could harbor HCV in the liver similar to occult HCV infections (OHCI) still persists. OHCI are defined as cases negative for anti-HCV antibodies and HCV RNA in blood but positive for HCV RNA in liver. [4] The assessment of OHCI in CC patients might have a critical implication in the management of this deadly disease. Therefore, our study aimed to investigate the presence of OHCI in liver biopsies of CC patients using a novel fluorescence resonance energy transfer (FRET) hybridization-based probe technology.
The study was approved by the Institutional Review Board and informed consent was obtained from all individuals included in the study. The study comprised three groups---group A (n=10) comprised anti-HCV antibodies and serum HCV RNA negative CC patients; group B (n=10) included anti-HCV antibody and serum HCV RNA-positive patients; group C (n=10) consisted of age and gender matched healthy controls. Liver biopsies from group A and EDTA blood from group B and C was collected and HCV RNA was isolated through RNeasy Mini Kit and QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany), following manufacturer's instructions. Isolated RNA was subjected for cDNA synthesis using Sensiscript RT Kit (Qiagen, Hilden, Germany) along with suitable primers (5´-CCCAACACTACTCGCCTA-3´; nucleotides 269 to 252). cDNA was then amplified and detected using Light Cycler 2.0 (Roche Applied Sciences, Mannheim, Germany) using appropriate primers and probes. The sequences used were forward primer HCV SF2 (5´GTGCAGCCTCCAGGACCCCC), reverse primer NAR3 (5´CCCTATCAGGCAGTACCACAA), FRET anchor probe HCVG-flourescein isothiocyanate (5´-GCCATAGTGGTCTGCGGAACCGGT); 5´-LCRed640 (GTACACCGGAATTGCCAGGA-phosphate-3´).
A positive fluorescence signal was detected in 3 out of 10 samples of group A (mean viral load 1.2 × 10 2 copies/mL) and in all the subjects of group B (mean viral load 5.8 × 10 4 copies/mL) indicating the presence of HCV RNA in these samples [Figure 1], further, genotype 3 was identified as the infecting genotype in all the positive cases. However, no false positive result was observed as no HCV RNA was detected in group C.  | Figure 1: Real-time PCR analysis for occult hepatitis c virus in liver biopsy specimens of cryptogenic cirrhosis patients
Click here to view |
In conclusion, it is a unique attempt to find out the presence of OHCI in the liver tissues of the patients with CC by applying FRET hybridization technology. Understanding the fact that patients with CC with OHCI are at increased risk of developing HCC, early specific identification of these cases using advanced and novel technologies is of great importance for the mankind. Such studies will not only be helpful in understanding the disease etiology of CC but also reveal usefulness of applying novel technologies in identifying the OHCI.
 Acknowledgements | |  |
The authors gratefully acknowledge Bhopal Memorial Hospital Trust for financial support and Mr. Naveen Kumar Khare for necessary technical assistance.
| References | | |
| 1. | Giannini EG, Marabotto E, Savarino V, Trevisani F, Di Nolfo MA, Del Poggio P, et al. Hepatocellular carcinoma in patients with cryptogenic cirrhosis. Clin Gastroenterol Hepatol 2009;7:580-5. 
|
| 2. | Guerrero-Preston R, Siegel A, Renz J, Vlahov D, Neugut A. HCV Infection and Cryptogenic Cirrhosis are Risk Factors for Hepatocellular Carcinoma Among Latinos in New York City. J Community Health 2009;34:500-5.
|
| 3. | Geller SA, Nichols WS, Rojter SE, Chan RC, Petrovic LM, Vierling JM, et al. Hepatitis C virus is not recoverable from liver tissue in cryptogenic cirrhosis: Failure to identify hepatitis C virus-RNA using reverse transcription-mediated polymerase chain reaction. Hum Pathol 1996;27:1161-5.
|
| 4. | Carreño V. Occult hepatitis C virus infection: A new form of hepatitis C. World J Gastroenterol 2006;12:6922-5.
|
Correspondence Address:
Pradyumna K Mishra
Division of Translational Research, Tata Memorial Centre, ACTREC, Kharghar, Navi Mumbai - 410 210
India
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/0377-4929.81609
[Figure 1] |
|
| This article has been cited by | | 1 |
Translation research in molecular disease diagnosis: Bridging gap from laboratory to practice |
|
| Mishra, P.K., Raghuram, G.V., Bhargava, A., Pathak, N. | | Journal of Global Infectious Diseases. 2011; 3(2): 205-206 | | [Pubmed] | | | 2 |
Occult hepatitis C virus elicits mitochondrial oxidative stress in lymphocytes and triggers PI3-kinase-mediated DNA damage response |
|
| Bhargava, A., Raghuram, G.V., Pathak, N., Varshney, S., Jatawa, S.K., Jain, D., Mishra, P.K. | | Free Radical Biology and Medicine. 2011; 51(9): 1806-1814 | | [Pubmed] | |
|
|
|
|
|
|
|
|
|
|
|
|
| Article Access Statistics | | | Viewed | 2273 | | | Printed | 65 | | | Emailed | 0 | | | PDF Downloaded | 79 | | | Comments | [Add] | | | Cited by others | 2 | | |
|
|
